Gene Page: NTNG2

Summary
GeneID  84628
Symbol  NTNG2
Synonyms  KIAA0625|KIAA1857|LHLL9381|Lmnt2|MGC21884|NTNG1|bA479K20.1
Description  netrin G2
See related  HGNC:14288|Ensembl:ENSG00000196358|HPRD:17650|
Locus tag  RP11-479K20.2
Gene type  protein-coding
Map location  9q34
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
AssociationA combined odds ratio method (Sun et al. 2008), association studies1Link to SZGene
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003674molecular_functionND-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007409axonogenesisISSneuron, axon, neurite (GO term level: 12)-
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005578proteinaceous extracellular matrixIEA-
GO:0005886plasma membraneIEA-
GO:0046658anchored to plasma membraneISS-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
EWSR1EWSEwing sarcoma breakpoint region 1Two-hybridBioGRID16189514 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
BENPORATH_SUZ12_TARGETS 1038678All SZGR genes in this pathway
BENPORATH_EED_TARGETS 1062725All SZGR genes in this pathway
BENPORATH_ES_WITH_H3K27ME3 1118744All SZGR genes in this pathway
BENPORATH_PRC2_TARGETS 652441All SZGR genes in this pathway
WHITEHURST_PACLITAXEL_SENSITIVITY 3919All SZGR genes in this pathway
ACEVEDO_METHYLATED_IN_LIVER_CANCER_DN 940425All SZGR genes in this pathway
MIKKELSEN_MEF_LCP_WITH_H3K27ME3 7035All SZGR genes in this pathway
BRUINS_UVC_RESPONSE_LATE 1137655All SZGR genes in this pathway
DELACROIX_RAR_BOUND_ES 462273All SZGR genes in this pathway
NABA_ECM_GLYCOPROTEINS 19699All SZGR genes in this pathway
NABA_CORE_MATRISOME 275148All SZGR genes in this pathway
NABA_BASEMENT_MEMBRANES 4022All SZGR genes in this pathway
NABA_MATRISOME 1028559All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-291131191Ahsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-34/449158164m8hsa-miR-34abrainUGGCAGUGUCUUAGCUGGUUGUU
hsa-miR-34cAGGCAGUGUAGUUAGCUGAUUGC
hsa-miR-449UGGCAGUGUAUUGUUAGCUGGU
hsa-miR-449bAGGCAGUGUAUUGUUAGCUGGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.