| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406918 |
Name | MIR129-2 |
Synonym | MIR-129b|MIRN129-2|mir-129-2;microRNA 129-2;MIR129-2;microRNA 129-2 |
Definition | hsa-mir-129-2 |
Position | 11p11.2 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 406918 |
Links to all GeneRIF Items | 406918 |
Links to iHOP | 406918 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>406918 : length: 21 ctttttgcggtctgggcttgc |
Protein Sequence |
>406918 : length: 3 N/A |