| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406937 |
Name | MIR145 |
Synonym | MIRN145|miR-145|miRNA145;microRNA 145;MIR145;microRNA 145 |
Definition | hsa-mir-145 |
Position | 5q32 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406937 |
Links to all GeneRIF Items | 406937 |
Links to iHOP | 406937 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406937 : length: 23 gtccagttttcccaggaatccct |
Protein Sequence | >406937 : length: 3 N/A |