| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 406957 |
Name | MIR181C |
Synonym | MIRN181C|mir-181c;microRNA 181c;MIR181C;microRNA 181c |
Definition | hsa-mir-181c |
Position | 19p13.13 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 406957 |
Links to all GeneRIF Items | 406957 |
Links to iHOP | 406957 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >406957 : length: 22 aacattcaacctgtcggtgagt |
Protein Sequence | >406957 : length: 3 N/A |