| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 442906 |
Name | MIR338 |
Synonym | MIRN338|hsa-mir-338;microRNA 338;MIR338;microRNA 338 |
Definition | - |
Position | 17q25.3 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 442906 |
Links to all GeneRIF Items | 442906 |
Links to iHOP | 442906 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >442906 : length: 22 aacaatatcctggtgctgagtg |
Protein Sequence | >442906 : length: 3 N/A |