|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
Basic Information | |
|---|---|
Gene ID | 406884 |
Name | MIRLET7B |
Synonym | LET7B|MIRNLET7B|hsa-let-7b|let-7b;microRNA let-7b;MIRLET7B;microRNA let-7b |
Definition | - |
Position | 22q13.31 |
Gene Type | miscRNA |
Source | Count: 2; Pubmed_search,Generif |
Literature support | Count: 2 PubMed records as below. |
Evidence Status | Description |
potential | "This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets." |
reviewed | The tumor suppressor microRNA let-7 represses the HMGA2 oncogene. |
| More detail of all 2 literatures about MIRLET7B | |
External Links | |
Links to Entrez Gene | 406884 |
Links to all GeneRIF Items | 406884 |
Links to iHOP | 406884 |
Sequence Information | |
Nucleotide Sequence | >406884 : length: 22 tgaggtagtaggttgtgtggtt |
|
Copyright © 2016-Present - The Univsersity of Texas Health Science Center at Houston Rights Reserved |