|
||
|
||
General information | Expression | Regulation | Mutation | Interaction |
Basic Information |
|
---|---|
Gene ID | 4771 |
Name | NF2 |
Synonymous | ACN|BANF|SCH;neurofibromin 2 (merlin);NF2;neurofibromin 2 (merlin) |
Definition | merlin|moesin-ezrin-radixin like|moesin-ezrin-radixin-like protein|moesin-ezrin-radizin-like protein|neurofibromin 2 (bilateral acoustic neuroma)|neurofibromin-2|schwannomerlin|schwannomin |
Position | 22q12.2 |
Gene Type | protein-coding |
Gene Mutation: | Substitution Insertion & Deletion Other Mutation |
Substitution | | Top | |
Mutation (Type; AA; Chr) |
Site |
Histology |
---|---|---|
Substitution - coding silent; c.816T>A; 22:28390984-28390984 |
soft_tissue; nerve_sheath | schwannoma |
Substitution - coding silent; c.810G>A; 22:28387328-28387328 |
soft_tissue; nerve_sheath | schwannoma |
Substitution - coding silent; c.57C>G; 22:28330044-28330044 |
pituitary; craniopharyngeal_duct | craniopharyngioma |
Substitution - coding silent; c.1113C>T; 22:28397928-28397928 |
meninges | meningothelial; meningioma |
Substitution - coding silent; c.1113C>T; 22:28397928-28397928 |
meninges | fibroblastic; meningioma |
Substitution - coding silent; c.189A>G; 22:28362814-28362814 |
meninges | meningioma |
Substitution - coding silent; c.810G>A; 22:28387328-28387328 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Indel | | Top | |
Mutation (Type; AA; Chr) |
Site |
Histology |
---|---|---|
Deletion - Frameshift; c.493delC; 22:28380691-28380691 |
meninges | meningioma |
Deletion - Frameshift; c.787_788delAA; 22:28387305-28387306 |
meninges | meningioma |
Deletion - Frameshift; c.1107delG; 22:28397922-28397922 |
meninges | meningioma |
Deletion - Frameshift; c.616delG; 22:28384194-28384194 |
soft_tissue; nerve_sheath; ulnary | schwannoma |
Deletion - Frameshift; c.1384delC; 22:28400868-28400868 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1373delT; 22:28400857-28400857 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.?_?del?; |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1101_1102delAA; 22:28397916-28397917 |
meninges | meningothelial; meningioma |
Deletion - Frameshift; c.1332_1335delAGAG; 22:28399467-28399470 |
meninges | meningothelial; meningioma |
Deletion - Frameshift; c.1217_1218delAG; 22:28399352-28399353 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.365_447del83; 22:28368192-28368274 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.675_810del136; |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.241_242delGT; 22:28365079-28365080 |
meninges | anaplastic; meningioma |
Deletion - Frameshift; c.813delT; 22:28390981-28390981 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.1132delG; 22:28399267-28399267 |
meninges | psammomatous; meningioma |
Deletion - In frame; c.357_359delCTT; 22:28365195-28365197 |
meninges | meningioma |
Deletion - Frameshift; c.429_432delTTAC; 22:28368256-28368259 |
meninges | meningioma |
Deletion - Frameshift; c.1435delC; 22:28400919-28400919 |
meninges | meningioma |
Deletion - Frameshift; c.1514_1515delTG; 22:28404252-28404253 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1513_1516delCTGT; 22:28404251-28404254 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.650delA; 22:28384228-28384228 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.1352delC; 22:28400836-28400836 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.745_755del11; 22:28387263-28387273 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.36_37delCT; 22:28330023-28330024 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.298delT; 22:28365136-28365136 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1001_1079del79; 22:28397816-28397894 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - In frame; c.250_300del51; 22:28365088-28365138 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.168_207del40; 22:28362793-28362832 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.482delG; 22:28380680-28380680 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.129_169del41; 22:28362754-28362794 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1408delC; 22:28400892-28400892 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.424_431delGCTTCTTA; 22:28368251-28368258 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1124delT; 22:28399259-28399259 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.643_656del14; 22:28384221-28384234 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1574delA; 22:28404312-28404312 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.282_283delTC; 22:28365120-28365121 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1238delA; 22:28399373-28399373 |
meninges | meningioma |
Deletion - Frameshift; c.61_85del25; 22:28330048-28330072 |
meninges | anaplastic; meningioma |
Deletion - Frameshift; c.1265_1265delA; 22:28399400-28399400 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.459delC; 22:28380657-28380657 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1578_1581delGGAA; 22:28407431-28407434 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.280_280delT; 22:28365118-28365118 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.154_175del22; 22:28362779-28362800 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - In frame; c.694_771del78; 22:28387212-28387289 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.563_576del14; 22:28381629-28381642 |
meninges | meningioma |
Deletion - Frameshift; c.1065_1066delGT; 22:28397880-28397881 |
meninges | meningioma |
Deletion - Frameshift; c.448_467del20; 22:28380646-28380665 |
meninges | meningioma |
Deletion - Frameshift; c.76delA; 22:28330063-28330063 |
meninges | meningioma |
Deletion - Frameshift; c.68_69delCC; 22:28330055-28330056 |
meninges | meningioma |
Deletion - Frameshift; c.440_492del53; |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.148delG; 22:28362773-28362773 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.619_620delTA; 22:28384197-28384198 |
meninges | meningioma |
Deletion - In frame; c.288_290delCTT; 22:28365126-28365128 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.692_693delAG; 22:28387210-28387211 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.1342delG; 22:28400826-28400826 |
meninges | angiomatous; meningioma |
Deletion - Frameshift; c.41_42delTC; 22:28330028-28330029 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.70delG; 22:28330057-28330057 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.271delC; 22:28365109-28365109 |
meninges | meningioma |
Deletion - Frameshift; c.911_921del11; 22:28394347-28394357 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.506delT; 22:28380704-28380704 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.653delG; 22:28384231-28384231 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.182_183delTC; 22:28362807-28362808 |
meninges | meningioma |
Deletion - Frameshift; c.1519_1520delTT; 22:28404257-28404258 |
meninges | meningothelial; meningioma |
Deletion - In frame; c.133_144del12; 22:28362758-28362769 |
meninges | meningothelial; meningioma |
Deletion - Frameshift; c.361_445del85; |
skin | malignant_melanoma |
Deletion - Frameshift; c.1099_1105delGCAACAA; 22:28397914-28397920 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.713delC; 22:28387231-28387231 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.324delG; 22:28365162-28365162 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.289delT; 22:28365127-28365127 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.339delC; 22:28365177-28365177 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.276_282delCACCTTT; 22:28365114-28365120 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.667delG; 22:28384245-28384245 |
meninges | meningothelial; meningioma |
Deletion - Frameshift; c.447delG; 22:28368274-28368274 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.933delG; 22:28394369-28394369 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - In frame; c.352_354delTTC; 22:28365190-28365192 |
meninges | meningioma |
Deletion - Frameshift; c.389delA; 22:28368216-28368216 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.227_240del14; 22:28362852-28362865 |
meninges | anaplastic; meningioma |
Deletion - Frameshift; c.154delC; 22:28362779-28362779 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.493delC; 22:28380691-28380691 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.291_337del47; 22:28365129-28365175 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1090_1108del19; 22:28397905-28397923 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.126delA; 22:28362751-28362751 |
meninges | meningioma |
Deletion - Frameshift; c.173delA; 22:28362798-28362798 |
meninges | meningioma |
Deletion - Frameshift; c.377delT; 22:28368204-28368204 |
meninges | meningioma |
Deletion - Frameshift; c.661delT; 22:28384239-28384239 |
meninges | meningioma |
Deletion - Frameshift; c.36_37delCT; 22:28330023-28330024 |
meninges | meningioma |
Deletion - Frameshift; c.1223_1236del14; 22:28399358-28399371 |
meninges | meningioma |
Deletion - In frame; c.?; |
meninges | meningioma |
Deletion - Frameshift; c.1088delT; 22:28397903-28397903 |
meninges | meningioma |
Deletion - Frameshift; c.165delG; 22:28362790-28362790 |
meninges | anaplastic; meningioma |
Deletion - Frameshift; c.592_593delCG; 22:28381658-28381659 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.346delC; 22:28365184-28365184 |
meninges | meningothelial; meningioma |
Deletion - In frame; c.352_354delTTC; 22:28365190-28365192 |
meninges | clear_cell; meningioma |
Deletion - Frameshift; c.807delG; 22:28387325-28387325 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.892delC; 22:28394328-28394328 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.265delG; 22:28365103-28365103 |
meninges | meningioma |
Deletion - Frameshift; c.610_626del17; 22:28384188-28384204 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1600delC; 22:28407453-28407453 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1621delG; 22:28407474-28407474 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.377delT; 22:28368204-28368204 |
meninges | transitional; meningioma |
Deletion - In frame; c.1000_1086del87; 22:28397815-28397901 |
skin | superficial_spreading; malignant_melanoma |
Deletion - Frameshift; c.616delG; 22:28384194-28384194 |
skin | malignant_melanoma |
Deletion - Frameshift; c.600_810del211; |
breast | ductal_carcinoma; carcinoma |
Deletion - In frame; c.417_755del339; |
central_nervous_system; spinal_cord | ependymoma_Grade_II; glioma |
Deletion - Frameshift; c.969_999del31; 22:28394405-28394435 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.224delT; 22:28362849-28362849 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.745delA; 22:28387263-28387263 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.489_541del53; |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.642_667del26; 22:28384220-28384245 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.37_88del52; 22:28330024-28330075 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.942delT; 22:28394378-28394378 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1347_1387del41; 22:28400831-28400871 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1022_1031del10; 22:28397837-28397846 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.744_754del11; 22:28387262-28387272 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.132_147del16; 22:28362757-28362772 |
meninges | meningothelial; meningioma |
Deletion - Frameshift; c.541delC; 22:28381607-28381607 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.182_183delTC; 22:28362807-28362808 |
meninges | meningioma |
Deletion - Frameshift; c.105delC; 22:28330092-28330092 |
meninges | atypical; meningioma |
Deletion - Frameshift; c.562_565delATTA; 22:28381628-28381631 |
meninges | anaplastic; meningioma |
Deletion - Frameshift; c.249delT; 22:28365087-28365087 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.1393delG; 22:28400877-28400877 |
kidney | clear_cell_renal_cell_carcinoma; carcinoma |
Deletion - Frameshift; c.1571_1572delAA; 22:28404309-28404310 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.602_603delAT; 22:28384180-28384181 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.602_603delAT; 22:28384180-28384181 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.1058_1064delGGGATGA; 22:28397873-28397879 |
meninges | meningioma |
Deletion - Frameshift; c.355_359delTTCTT; 22:28365193-28365197 |
meninges | meningioma |
Deletion - Frameshift; c.1051delC; 22:28397866-28397866 |
meninges | meningioma |
Deletion - Frameshift; c.?; |
meninges | meningioma |
Deletion - Frameshift; c.?; |
meninges | meningioma |
Deletion - Frameshift; c.?; |
meninges | meningioma |
Deletion - In frame; c.364_447del84; 22:28368191-28368274 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1092delA; 22:28397907-28397907 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.640delC; 22:28384218-28384218 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.89_99del11; 22:28330076-28330086 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.1217_1218delAG; 22:28399352-28399353 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1340_1445del106; |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1340_1347delGGGCCAAA; |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1254delC; 22:28399389-28399389 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.41_42delTC; 22:28330028-28330029 |
meninges | meningioma |
Deletion - Frameshift; c.1445delC; 22:28400929-28400929 |
meninges | meningioma |
Deletion - In frame; c.757_795del39; 22:28387275-28387313 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.171_216del46; 22:28362796-28362841 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1390delG; 22:28400874-28400874 |
meninges | psammomatous; meningioma |
Deletion - Frameshift; c.1519_1528del10; 22:28404257-28404266 |
meninges | transitional; meningioma |
Deletion - In frame; c.886_999del114; 22:28394322-28394435 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.500_501delAA; 22:28380698-28380699 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.601delG; 22:28384179-28384179 |
central_nervous_system; spinal_cord | ependymoma_Grade_II; glioma |
Deletion - In frame; c.379_1146del768; |
central_nervous_system; spinal_cord | ependymoma_Grade_II; glioma |
Deletion - Frameshift; c.792_796delCTCGT; 22:28387310-28387314 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.428_438del11; 22:28368255-28368265 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.732delT; 22:28387250-28387250 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.932delG; 22:28394368-28394368 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1571_1574delAAAA; 22:28404309-28404312 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.399delC; 22:28368226-28368226 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1189_1195delCTTCTGG; 22:28399324-28399330 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1357delC; 22:28400841-28400841 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.459delC; 22:28380657-28380657 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1570delG; 22:28404308-28404308 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1223_1227delAAATG; 22:28399358-28399362 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.385delG; 22:28368212-28368212 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.212delC; 22:28362837-28362837 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1413delG; 22:28400897-28400897 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.314_327delCTGAAGAGGAGCTG; 22:28365150-28365163 |
kidney | renal_cell_carcinoma; carcinoma |
Deletion - Frameshift; c.314_327delCTGAAGAGGAGCTG; 22:28365150-28365163 |
kidney | renal_cell_carcinoma; carcinoma |
Deletion - Frameshift; c.1459delA; 22:28404197-28404197 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1148_1182del35; 22:28399283-28399317 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.743_743delA; 22:28387261-28387261 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.1058_1064delGGGATGA; 22:28397873-28397879 |
meninges | meningioma |
Deletion - Frameshift; c.305delC; 22:28365143-28365143 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - In frame; c.288_290delCTT; 22:28365126-28365128 |
meninges | meningioma |
Deletion - In frame; c.366_386del21; 22:28368193-28368213 |
meninges | meningioma |
Deletion - Frameshift; c.459delC; 22:28380657-28380657 |
meninges | meningioma |
Deletion - Frameshift; c.606delA; 22:28384184-28384184 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1059_1060delGG; 22:28397874-28397875 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1092_1095delAGAA; 22:28397907-28397910 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1188_1191delACTT; 22:28399323-28399326 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1389_1408del20; 22:28400873-28400892 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.1082_1106del25; 22:28397897-28397921 |
meninges | meningothelial; meningioma |
Deletion - Frameshift; c.1469delC; 22:28404207-28404207 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1614delG; 22:28407467-28407467 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1474_1478delCCTCC; 22:28404212-28404216 |
meninges | papillary; meningioma |
Deletion - Frameshift; c.1001_1004delTGGA; 22:28397816-28397819 |
meninges | papillary; meningioma |
Deletion - Frameshift; c.1332_1333delAG; 22:28399467-28399468 |
meninges | psammomatous; meningioma |
Deletion - Frameshift; c.1001_1004delTGGA; 22:28397816-28397819 |
meninges | psammomatous; meningioma |
Deletion - Frameshift; c.234delC; 22:28362859-28362859 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.488delT; 22:28380686-28380686 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.1264delG; 22:28399399-28399399 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.1191delT; 22:28399326-28399326 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.1333_1336delGAGA; 22:28399468-28399471 |
meninges | meningioma |
Deletion - Frameshift; c.421_424delCTGG; 22:28368248-28368251 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.153_157delCCGGA; 22:28362778-28362782 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.441delG; 22:28368268-28368268 |
soft_tissue; nerve_sheath; spinal | schwannoma |
Deletion - Frameshift; c.1474_1478delCCTCC; 22:28404212-28404216 |
soft_tissue; nerve_sheath; spine | myxoma |
Deletion - Frameshift; c.1584delC; 22:28407437-28407437 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.735delC; 22:28387253-28387253 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1040delA; 22:28397855-28397855 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.955delC; 22:28394391-28394391 |
soft_tissue; nerve_sheath; spinal | schwannoma |
Deletion - Frameshift; c.304delC; 22:28365142-28365142 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.264delG; 22:28365102-28365102 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.153delC; 22:28362778-28362778 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.1050delA; 22:28397865-28397865 |
meninges | angiomatous; meningioma |
Deletion - Frameshift; c.?_?del?; |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.394_394delT; 22:28368221-28368221 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1003_1012del10; 22:28397818-28397827 |
pleura | mesothelioma |
Deletion - Frameshift; c.1356delT; 22:28400840-28400840 |
meninges | meningioma |
Deletion - In frame; c.329_424del96; |
meninges | meningioma |
Deletion - Frameshift; c.1198delC; 22:28399333-28399333 |
meninges | meningothelial; meningioma |
Deletion - Frameshift; c.809delA; 22:28387327-28387327 |
meninges | fibroblastic; meningioma |
Deletion - In frame; c.364_447del84; 22:28368191-28368274 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1438delA; 22:28400922-28400922 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.621delT; 22:28384199-28384199 |
central_nervous_system; spinal_cord | ependymoma_Grade_II; glioma |
Deletion - Frameshift; c.27_33delGAGCTTC; 22:28330014-28330020 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.205_211delAAGGACA; 22:28362830-28362836 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1058delG; 22:28397873-28397873 |
meninges | meningioma |
Deletion - Frameshift; c.479delG; 22:28380677-28380677 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - In frame; c.358_375del18; |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1123_1265del143; 22:28399258-28399400 |
skin | malignant_melanoma |
Deletion - Frameshift; c.?_?del?; |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.977_980delGGGA; 22:28394413-28394416 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1614delG; 22:28407467-28407467 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.618_669del52; 22:28384196-28384247 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.623_674del52; 22:28384201-28384252 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1286delA; 22:28399421-28399421 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1184delC; 22:28399319-28399319 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.490_496delGCCCAAG; 22:28380688-28380694 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.993delA; 22:28394429-28394429 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.750delG; 22:28387268-28387268 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.659_665delACTACTT; 22:28384237-28384243 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.905_912delGGAACCAT; 22:28394341-28394348 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.?_?del?; |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.62delC; 22:28330049-28330049 |
meninges | meningioma |
Deletion - Frameshift; c.866delA; 22:28391034-28391034 |
meninges | meningioma |
Deletion - In frame; c.115_240del126; 22:28362740-28362865 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1039_1042delGAGG; 22:28397854-28397857 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.282_357del76; 22:28365120-28365195 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - In frame; c.357_359delCTT; 22:28365195-28365197 |
meninges | meningioma |
Deletion - Frameshift; c.1443delC; 22:28400927-28400927 |
meninges | meningioma |
Deletion - Frameshift; c.1023_1044del22; 22:28397838-28397859 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1198delC; 22:28399333-28399333 |
meninges | meningothelial; meningioma |
Deletion - Frameshift; c.453_465del13; 22:28380651-28380663 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.89_99del11; 22:28330076-28330086 |
meninges | fibroblastic; meningioma |
Deletion - In frame; c.115_240del126; 22:28362740-28362865 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - In frame; c.613_621del9; 22:28384191-28384199 |
meninges | atypical; meningioma |
Deletion - Frameshift; c.70delG; 22:28330057-28330057 |
meninges | atypical; meningioma |
Deletion - Frameshift; c.95_96delAG; 22:28330082-28330083 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.610delG; 22:28384188-28384188 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.1334_1337delAGAG; 22:28399469-28399472 |
meninges | meningothelial; meningioma |
Deletion - Frameshift; c.1080delG; 22:28397895-28397895 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.768delC; 22:28387286-28387286 |
soft_tissue; nerve_sheath; spine | myxoma |
Deletion - In frame; c.676_810del135; 22:28387194-28387328 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - In frame; c.364_447del84; 22:28368191-28368274 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1575_1737del163; 22:28407428-28407590 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - In frame; c.115_240del126; 22:28362740-28362865 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - In frame; c.364_447del84; 22:28368191-28368274 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - In frame; c.1504_1731del228; |
skin | malignant_melanoma |
Deletion - Frameshift; c.?_?del?; |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1637delT; 22:28407490-28407490 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.778_811del34; |
soft_tissue; nerve_sheath; spinal | schwannoma |
Deletion - Frameshift; c.908delA; 22:28394344-28394344 |
central_nervous_system; spinal_cord | ependymoma_Grade_II; glioma |
Deletion - Frameshift; c.1362_1390del29; 22:28400846-28400874 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.472_473delCA; 22:28380670-28380671 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1163delC; 22:28399298-28399298 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.45delG; 22:28330032-28330032 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1451_1452delTG; 22:28404189-28404190 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1636delA; 22:28407489-28407489 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.439delC; 22:28368266-28368266 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.88_109del22; 22:28330075-28330096 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - In frame; c.70_84del15; 22:28330057-28330071 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.141delT; 22:28362766-28362766 |
meninges | atypical; meningioma |
Deletion - Frameshift; c.1185delA; 22:28399320-28399320 |
meninges | anaplastic; meningioma |
Deletion - Frameshift; c.1457_1466delCAATTCCAGC; 22:28404194-28404203 |
pleura | mesothelioma |
Deletion - Frameshift; c.514delA; 22:28380712-28380712 |
endometrium | mixed_adenosquamous_carcinoma; carcinoma |
Deletion - Frameshift; c.305delC; 22:28365143-28365143 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.493delC; 22:28380691-28380691 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.743_743delA; 22:28387261-28387261 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.1149_1150delGT; 22:28399284-28399285 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.286_298del13; 22:28365124-28365136 |
meninges | meningioma |
Deletion - Frameshift; c.347delA; 22:28365185-28365185 |
meninges | meningioma |
Deletion - Frameshift; c.496_497delGA; 22:28380694-28380695 |
meninges | meningioma |
Deletion - Frameshift; c.563_564delTT; 22:28381629-28381630 |
meninges | meningioma |
Deletion - Frameshift; c.209delA; 22:28362834-28362834 |
meninges | meningioma |
Deletion - Frameshift; c.153_165del13; 22:28362778-28362790 |
meninges | meningioma |
Deletion - In frame; c.364_447del84; 22:28368191-28368274 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.257delT; 22:28365095-28365095 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.815_822delCTATTAAA; 22:28390983-28390990 |
meninges | meningioma |
Deletion - Frameshift; c.936delA; 22:28394372-28394372 |
meninges | anaplastic; meningioma |
Deletion - Frameshift; c.301delT; 22:28365139-28365139 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.346_347delCA; 22:28365184-28365185 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.453_465del13; 22:28380651-28380663 |
meninges | transitional; meningioma |
Deletion - In frame; c.357_359delCTT; 22:28365195-28365197 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.813_816delTACT; 22:28390981-28390984 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.1579_1582delGAAT; 22:28407432-28407435 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.138_139delCT; 22:28362763-28362764 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.618_619delAT; 22:28384196-28384197 |
meninges | meningioma |
Deletion - Frameshift; c.739delG; 22:28387257-28387257 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.737delC; 22:28387255-28387255 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.128_131delGGAA; 22:28362753-28362756 |
meninges | meningioma |
Deletion - Frameshift; c.750delG; 22:28387268-28387268 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.681_690del10; 22:28387199-28387208 |
central_nervous_system; spinal_cord | anaplastic; ependymoma_Grade_III-IV; glioma |
Deletion - In frame; c.433_489del57; |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1447_1571del125; 22:28404185-28404309 |
skin | malignant_melanoma |
Deletion - In frame; c.811_885del75; 22:28390979-28391053 |
central_nervous_system; spinal_cord | ependymoma_Grade_II; glioma |
Deletion - Frameshift; c.1435delC; 22:28400919-28400919 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1373delT; 22:28400857-28400857 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1469delC; 22:28404207-28404207 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.1089delG; 22:28397904-28397904 |
meninges | transitional; meningioma |
Deletion - Frameshift; c.1199delA; 22:28399334-28399334 |
meninges | psammomatous; meningioma |
Deletion - Frameshift; c.844delG; 22:28391012-28391012 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.1266_1267delGA; 22:28399401-28399402 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.729_732delTTAT; 22:28387247-28387250 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.134delA; 22:28362759-28362759 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Deletion - Frameshift; c.914_935del22; 22:28394350-28394371 |
meninges | atypical; meningioma |
Deletion - Frameshift; c.1397delG; 22:28400881-28400881 |
meninges | meningioma |
Deletion - Frameshift; c.838_842delATTGA; 22:28391006-28391010 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.128_131delGGAA; 22:28362753-28362756 |
meninges | meningioma |
Deletion - Frameshift; c.?_?del?; |
meninges | meningioma |
Deletion - Frameshift; c.1132delG; 22:28399267-28399267 |
meninges | atypical; meningioma |
Deletion - Frameshift; c.683delA; 22:28387201-28387201 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.995delA; 22:28394431-28394431 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.683delA; 22:28387201-28387201 |
stomach | adenocarcinoma; carcinoma |
Deletion - In frame; c.379_402del24; 22:28368206-28368229 |
soft_tissue; nerve_sheath | schwannoma |
Deletion - Frameshift; c.493delC; 22:28380691-28380691 |
meninges | fibroblastic; meningioma |
Deletion - Frameshift; c.1379_1379delA; 22:28400863-28400863 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Other Mutation | | Top | |
Mutation (Type; AA; Chr) |
Site |
Histology |
---|---|---|
Complex - deletion inframe; c.38_58del21; 22:28330025-28330045 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Complex - frameshift; c.1574_1575AA>TGCTGTGGGCAGCTGTGAACTAGACTGAGTGATTGGGGCCTTGGGAAGCTGGGGCAGAG; |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Complex - frameshift; c.233_233A>?; 22:28362858-28362858 |
soft_tissue; nerve_sheath; cranial | schwannoma |
Complex - frameshift; c.1531_1563>AATAC; 22:28404269-28404301 |
soft_tissue; nerve_sheath | schwannoma |
Complex - frameshift; c.?; |
meninges | meningioma |
Complex - frameshift; c.53_54AA>T; 22:28330040-28330041 |
meninges | meningioma |
Complex - frameshift; c.?; |
meninges | meningioma |
Complex - frameshift; c.1439_1445CGTACCC>CTGGGGCTGCCTTAGTCCTG; 22:28400923-28400929 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Complex - deletion inframe; c.174_197del24; 22:28362799-28362822 |
meninges | transitional; meningioma |
Complex - deletion inframe; c.302_304delATC; 22:28365140-28365142 |
meninges | transitional; meningioma |
Complex - frameshift; c.733_794>T; 22:28387251-28387312 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Complex - frameshift; c.634_657>A; 22:28384212-28384235 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Complex - frameshift; c.?; |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Complex - frameshift; c.1178_1185AGGAGGCA>C; 22:28399313-28399320 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Complex - frameshift; c.840_841>A; 22:28391008-28391009 |
kidney | carcinoma |
Complex - frameshift; c.378_388>CT; 22:28368205-28368215 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Complex - frameshift; c.1376_1409>CG; 22:28400860-28400893 |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Complex - frameshift; c.507_518>C; |
soft_tissue; nerve_sheath; vestibular | schwannoma |
Complex - frameshift; c.573_581GTACGCAGA>T; 22:28381639-28381647 |
meninges | anaplastic; meningioma |
Complex - deletion inframe; c.257_331del75; 22:28365095-28365169 |
soft_tissue; nerve_sheath | schwannoma |
Copyright © 2016-Present - The Univsersity of Texas Health Science Center at Houston Rights Reserved |