Gene Page: CRTAP
Summary ?
GeneID | 10491 |
Symbol | CRTAP |
Synonyms | CASP|LEPREL3|OI7|P3H5 |
Description | cartilage associated protein |
Reference | MIM:605497|HGNC:HGNC:2379|Ensembl:ENSG00000170275|HPRD:16110|Vega:OTTHUMG00000130746 |
Gene type | protein-coding |
Map location | 3p22.3 |
Pascal p-value | 0.12 |
Fetal beta | -0.27 |
DMG | 1 (# studies) |
eGene | Cerebellum |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg04397936 | 3 | 33155330 | CRTAP | 5.37E-12 | -0.012 | 1.78E-7 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
PXMP3 | 0.71 | 0.66 |
PIGP | 0.71 | 0.56 |
TMEM126A | 0.71 | 0.66 |
CGRRF1 | 0.70 | 0.63 |
C18orf32 | 0.70 | 0.57 |
TMEM14C | 0.70 | 0.57 |
CMC1 | 0.70 | 0.66 |
GSTO1 | 0.70 | 0.69 |
NDUFB1 | 0.69 | 0.55 |
ATP5G3 | 0.69 | 0.52 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
TNKS1BP1 | -0.53 | -0.57 |
HIP1R | -0.51 | -0.59 |
SAFB2 | -0.50 | -0.51 |
GIGYF2 | -0.50 | -0.50 |
ZC3H13 | -0.49 | -0.51 |
LRP1 | -0.49 | -0.52 |
USP36 | -0.49 | -0.52 |
PHLDB1 | -0.49 | -0.55 |
SUPT6H | -0.49 | -0.49 |
MAP4K4 | -0.49 | -0.56 |
Section III. Gene Ontology annotation
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005576 | extracellular region | IEA | - | |
GO:0005578 | proteinaceous extracellular matrix | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME EXTRACELLULAR MATRIX ORGANIZATION | 87 | 42 | All SZGR 2.0 genes in this pathway |
REACTOME COLLAGEN FORMATION | 58 | 31 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
DAVICIONI MOLECULAR ARMS VS ERMS DN | 182 | 111 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
COLDREN GEFITINIB RESISTANCE UP | 85 | 57 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS CDC25 DN | 51 | 35 | All SZGR 2.0 genes in this pathway |
CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS DN | 142 | 95 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
YANAGIHARA ESX1 TARGETS | 30 | 19 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
WEI MIR34A TARGETS | 148 | 97 | All SZGR 2.0 genes in this pathway |
IGLESIAS E2F TARGETS UP | 151 | 103 | All SZGR 2.0 genes in this pathway |
RAMALHO STEMNESS UP | 206 | 118 | All SZGR 2.0 genes in this pathway |
AMUNDSON POOR SURVIVAL AFTER GAMMA RADIATION 2G | 171 | 96 | All SZGR 2.0 genes in this pathway |
BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
BHATI G2M ARREST BY 2METHOXYESTRADIOL DN | 127 | 75 | All SZGR 2.0 genes in this pathway |
CHANG CORE SERUM RESPONSE DN | 209 | 137 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 16 | 79 | 47 | All SZGR 2.0 genes in this pathway |
NIELSEN GIST | 98 | 66 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
VANLOO SP3 TARGETS DN | 89 | 47 | All SZGR 2.0 genes in this pathway |
BOUDOUKHA BOUND BY IGF2BP2 | 111 | 59 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 83 | 89 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-331 | 4776 | 4782 | m8 | hsa-miR-331brain | GCCCCUGGGCCUAUCCUAGAA |
miR-335 | 4600 | 4606 | 1A | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.