Gene Page: SUPT16H
Summary ?
GeneID | 11198 |
Symbol | SUPT16H |
Synonyms | CDC68|FACTP140|SPT16|SPT16/CDC68 |
Description | SPT16 homolog, facilitates chromatin remodeling subunit |
Reference | MIM:605012|HGNC:HGNC:11465|Ensembl:ENSG00000092201|HPRD:16088|Vega:OTTHUMG00000029685 |
Gene type | protein-coding |
Map location | 14q11.2 |
Pascal p-value | 0.015 |
Sherlock p-value | 0.704 |
Support | Potential synaptic genes |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.047 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0008159 | positive transcription elongation factor activity | TAS | 10421373 | |
GO:0008235 | metalloexopeptidase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006337 | nucleosome disassembly | TAS | 10421373 | |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0006350 | transcription | IEA | - | |
GO:0006508 | proteolysis | IEA | - | |
GO:0006366 | transcription from RNA polymerase II promoter | TAS | 10421373 | |
GO:0006281 | DNA repair | IEA | - | |
GO:0006260 | DNA replication | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005654 | nucleoplasm | EXP | 12676794 | |
GO:0005694 | chromosome | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME RNA POL II TRANSCRIPTION | 105 | 54 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSCRIPTION | 210 | 127 | All SZGR 2.0 genes in this pathway |
REACTOME FORMATION OF RNA POL II ELONGATION COMPLEX | 45 | 19 | All SZGR 2.0 genes in this pathway |
REACTOME ELONGATION ARREST AND RECOVERY | 32 | 14 | All SZGR 2.0 genes in this pathway |
REACTOME RNA POL II PRE TRANSCRIPTION EVENTS | 61 | 32 | All SZGR 2.0 genes in this pathway |
REACTOME HIV INFECTION | 207 | 122 | All SZGR 2.0 genes in this pathway |
REACTOME HIV LIFE CYCLE | 125 | 69 | All SZGR 2.0 genes in this pathway |
REACTOME LATE PHASE OF HIV LIFE CYCLE | 104 | 61 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS UP | 238 | 144 | All SZGR 2.0 genes in this pathway |
SENESE HDAC2 TARGETS UP | 114 | 66 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
HAHTOLA MYCOSIS FUNGOIDES SKIN UP | 177 | 113 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
JAZAG TGFB1 SIGNALING UP | 108 | 69 | All SZGR 2.0 genes in this pathway |
FALVELLA SMOKERS WITH LUNG CANCER | 80 | 52 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
KAUFFMANN DNA REPAIR GENES | 230 | 137 | All SZGR 2.0 genes in this pathway |
ZHANG RESPONSE TO CANTHARIDIN DN | 69 | 46 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
DAIRKEE CANCER PRONE RESPONSE BPA E2 | 118 | 65 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN DN | 249 | 165 | All SZGR 2.0 genes in this pathway |
CHUNG BLISTER CYTOTOXICITY UP | 134 | 84 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C D UP | 139 | 95 | All SZGR 2.0 genes in this pathway |
ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
FOURNIER ACINAR DEVELOPMENT LATE 2 | 277 | 172 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA CLASSES UP | 605 | 377 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
WANG METASTASIS OF BREAST CANCER ESR1 UP | 22 | 14 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS GROWING | 243 | 155 | All SZGR 2.0 genes in this pathway |
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 DN | 157 | 106 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
BILANGES SERUM SENSITIVE GENES | 90 | 54 | All SZGR 2.0 genes in this pathway |
ABRAMSON INTERACT WITH AIRE | 45 | 33 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-133 | 142 | 148 | 1A | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
miR-15/16/195/424/497 | 900 | 906 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-431 | 346 | 352 | 1A | hsa-miR-431 | UGUCUUGCAGGCCGUCAUGCA |
miR-495 | 1099 | 1105 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.