SZGR2

Summary ?

GeneID	1399
Symbol	CRKL
Synonyms	-
Description	v-crk avian sarcoma virus CT10 oncogene homolog-like
Reference	MIM:602007\|HGNC:HGNC:2363\|Ensembl:ENSG00000099942\|HPRD:03596\|Vega:OTTHUMG00000150807
Gene type	protein-coding
Map location	22q11.21
Pascal p-value	0.235
Sherlock p-value	0.371
Fetal beta	0.07
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CNV:YES	Copy number variation studies	Manual curation
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
GSMA_I	Genome scan meta-analysis	Psr: 0.031
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1445

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg13720744	22	21271392	CRKL	2.82E-10	-0.014	6.59E-7	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SLC8A2	0.90	0.91
CCDC85A	0.89	0.90
FBXO41	0.89	0.89
TLN2	0.88	0.89
KIAA1045	0.87	0.89
RAB11FIP4	0.87	0.86
CLSTN1	0.87	0.86
LRP11	0.86	0.89
PIP5K1C	0.86	0.86
SULT4A1	0.86	0.89

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AP002478.3	-0.52	-0.53
AL139819.3	-0.51	-0.50
AF347015.21	-0.51	-0.38
GNG11	-0.48	-0.44
C11orf67	-0.48	-0.51
NSBP1	-0.48	-0.52
C1orf54	-0.48	-0.45
AF347015.18	-0.47	-0.38
RAB13	-0.46	-0.55
AL138743.2	-0.46	-0.46

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005070	SH3/SH2 adaptor activity	TAS		8798523
GO:0005515	protein binding	IPI		9788432 \|16284401
GO:0004713	protein tyrosine kinase activity	TAS		8361759
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001568	blood vessel development	IEA		-
GO:0007265	Ras protein signal transduction	TAS		8798523
GO:0007254	JNK cascade	TAS		8798523
GO:0007242	intracellular signaling cascade	TAS		8361759
GO:0009952	anterior/posterior pattern formation	IEA		-
GO:0009887	organ morphogenesis	IEA		-
GO:0007507	heart development	IEA		-
GO:0007389	pattern specification process	IEA		-
GO:0060017	parathyroid gland development	IEA		-
GO:0048538	thymus development	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005737	cytoplasm	IDA		18029348
GO:0005886	plasma membrane	IDA		18029348

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	7926767 \|8083188 \|8978305 \|9820532
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	-	HPRD	7493940
ANK3	ANKYRIN-G \| FLJ45464	ankyrin 3, node of Ranvier (ankyrin G)	Affinity Capture-Western	BioGRID	10907644
BCAR1	CAS \| CAS1 \| CASS1 \| CRKAS \| P130Cas	breast cancer anti-estrogen resistance 1	-	HPRD,BioGRID	10753828
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	Affinity Capture-Western Far Western Two-hybrid	BioGRID	8978305 \|9747873 \|10194128 \|15143164
BLNK	BASH \| BLNK-S \| LY57 \| MGC111051 \| SLP-65 \| SLP65	B-cell linker	-	HPRD,BioGRID	11489945
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	Affinity Capture-Western Reconstituted Complex	BioGRID	9092574 \|9162067 \|9344843 \|9461587 \|9590251 \|9820532 \|10204582 \|10907644 \|11133830 \|12244174
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	-	HPRD	9162067 \|9590251 \|12244174
CBLB	DKFZp686J10223 \| DKFZp779A0729 \| DKFZp779F1443 \| FLJ36865 \| FLJ41152 \| Nbla00127 \| RNF56	Cas-Br-M (murine) ecotropic retroviral transforming sequence b	-	HPRD,BioGRID	10022120
CD34	-	CD34 molecule	-	HPRD,BioGRID	11389015
CRK	CRKII	v-crk sarcoma virus CT10 oncogene homolog (avian)	-	HPRD	9614078
DNM2	CMTDI1 \| CMTDIB \| DI-CMTB \| DYN2 \| DYNII	dynamin 2	An unspecified isoform of Dyn2 interacts with CrkL. This interaction was modeled on a demonstrated interaction between human Dyn2 and CrkL from an unspecified species.	BIND	15696170
DOCK2	FLJ46592 \| KIAA0209	dedicator of cytokinesis 2	-	HPRD,BioGRID	12393632
DOK1	MGC117395 \| MGC138860 \| P62DOK	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	-	HPRD,BioGRID	11071635
EPOR	MGC138358	erythropoietin receptor	-	HPRD,BioGRID	11443118
ETV6	TEL \| TEL/ABL	ets variant 6	Affinity Capture-Western	BioGRID	15143164
EVL	RNB6	Enah/Vasp-like	-	HPRD	10945997
FCGR1A	CD64 \| CD64A \| FCRI \| FLJ18345 \| IGFR1	Fc fragment of IgG, high affinity Ia, receptor (CD64)	-	HPRD,BioGRID	9820532
GAB1	-	GRB2-associated binding protein 1	-	HPRD,BioGRID	10753869
GAB2	KIAA0571	GRB2-associated binding protein 2	-	HPRD,BioGRID	11334882
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD,BioGRID	10477741
IFNAR1	AVP \| IFN-alpha-REC \| IFNAR \| IFNBR \| IFRC	interferon (alpha, beta and omega) receptor 1	-	HPRD	11167825
INPP5D	MGC104855 \| MGC142140 \| MGC142142 \| SHIP \| SHIP1 \| SIP-145 \| hp51CN	inositol polyphosphate-5-phosphatase, 145kDa	Affinity Capture-Western Reconstituted Complex	BioGRID	11443118
IRS4	IRS-4 \| PY160	insulin receptor substrate 4	-	HPRD,BioGRID	9614078
KIDINS220	ARMS \| MGC163482	kinase D-interacting substrate, 220kDa	-	HPRD	15167895
KIT	C-Kit \| CD117 \| PBT \| SCFR	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	-	HPRD,BioGRID	9092574
MAP4K1	HPK1	mitogen-activated protein kinase kinase kinase kinase 1	HPK1, a Ste-20 homologous serine/threonine kinase phosphorylates CrkL, a Crk-like adaptor protein	BIND	9891069
MAP4K1	HPK1	mitogen-activated protein kinase kinase kinase kinase 1	-	HPRD,BioGRID	9891069 \|11279207
MAP4K5	GCKR \| KHS \| KHS1 \| MAPKKKK5	mitogen-activated protein kinase kinase kinase kinase 5	-	HPRD,BioGRID	10648385
NEDD9	CAS-L \| CAS2 \| CASL \| CASS2 \| HEF1 \| dJ49G10.2 \| dJ761I2.1	neural precursor cell expressed, developmentally down-regulated 9	-	HPRD	9020138 \|9405482 \|9498705
NEDD9	CAS-L \| CAS2 \| CASL \| CASS2 \| HEF1 \| dJ49G10.2 \| dJ761I2.1	neural precursor cell expressed, developmentally down-regulated 9	Affinity Capture-Western Reconstituted Complex	BioGRID	9020138 \|9162067 \|9498705 \|9820532
PDGFRA	CD140A \| MGC74795 \| PDGFR2 \| Rhe-PDGFRA	platelet-derived growth factor receptor, alpha polypeptide	-	HPRD,BioGRID	9546424
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	Affinity Capture-Western	BioGRID	9461587
PIK3R2	P85B \| p85 \| p85-BETA	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	-	HPRD,BioGRID	9092574
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	Two-hybrid	BioGRID	15494733
PTPN11	BPTP3 \| CFC \| MGC14433 \| NS1 \| PTP-1D \| PTP2C \| SH-PTP2 \| SH-PTP3 \| SHP2	protein tyrosine phosphatase, non-receptor type 11	-	HPRD,BioGRID	9344843
PXN	FLJ16691	paxillin	-	HPRD,BioGRID	7493940
RAPGEF1	C3G \| DKFZp781P1719 \| GRF2	Rap guanine nucleotide exchange factor (GEF) 1	Crk-L interacts with C3G.	BIND	8621483
RAPGEF1	C3G \| DKFZp781P1719 \| GRF2	Rap guanine nucleotide exchange factor (GEF) 1	-	HPRD,BioGRID	8621483 \|9344843 \|9374471
RICS	GC-GAP \| GRIT \| KIAA0712 \| MGC1892 \| p200RhoGAP \| p250GAP	Rho GTPase-activating protein	-	HPRD,BioGRID	12446789
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD,BioGRID	9344843
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	-	HPRD	9162067
STAT5A	MGF \| STAT5	signal transducer and activator of transcription 5A	-	HPRD,BioGRID	9837784 \|11167825
SYK	DKFZp313N1010 \| FLJ25043 \| FLJ37489	spleen tyrosine kinase	CrkL interacts with Syk.	BIND	11313252
SYK	DKFZp313N1010 \| FLJ25043 \| FLJ37489	spleen tyrosine kinase	-	HPRD,BioGRID	11313252
TGFB1I1	ARA55 \| HIC-5 \| HIC5 \| TSC-5	transforming growth factor beta 1 induced transcript 1	-	HPRD	9858471 \|11463817
TYK2	JTK1	tyrosine kinase 2	-	HPRD,BioGRID	9374471
WAS	IMD2 \| THC \| WASP	Wiskott-Aldrich syndrome (eczema-thrombocytopenia)	-	HPRD,BioGRID	11313252
WAS	IMD2 \| THC \| WASP	Wiskott-Aldrich syndrome (eczema-thrombocytopenia)	CrkL interacts with WASP.	BIND	11313252
WIPF1	MGC111041 \| PRPL-2 \| WASPIP \| WIP	WAS/WASL interacting protein family, member 1	WIP interacts with CrkL.	BIND	12504004
ZAP70	FLJ17670 \| FLJ17679 \| SRK \| STD \| TZK \| ZAP-70	zeta-chain (TCR) associated protein kinase 70kDa	ZAP-70 interacts with CrkL. This interaction was modeled on a demonstrated interaction between human ZAP-70 and CrkL from an unspecified species.	BIND	10419455

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG ERBB SIGNALING PATHWAY	87	71	All SZGR 2.0 genes in this pathway
KEGG CHEMOKINE SIGNALING PATHWAY	190	128	All SZGR 2.0 genes in this pathway
KEGG FOCAL ADHESION	201	138	All SZGR 2.0 genes in this pathway
KEGG FC GAMMA R MEDIATED PHAGOCYTOSIS	97	71	All SZGR 2.0 genes in this pathway
KEGG NEUROTROPHIN SIGNALING PATHWAY	126	103	All SZGR 2.0 genes in this pathway
KEGG REGULATION OF ACTIN CYTOSKELETON	216	144	All SZGR 2.0 genes in this pathway
KEGG INSULIN SIGNALING PATHWAY	137	103	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG RENAL CELL CARCINOMA	70	60	All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA	73	59	All SZGR 2.0 genes in this pathway
BIOCARTA IL2RB PATHWAY	38	26	All SZGR 2.0 genes in this pathway
BIOCARTA GLEEVEC PATHWAY	23	17	All SZGR 2.0 genes in this pathway
BIOCARTA INTEGRIN PATHWAY	38	29	All SZGR 2.0 genes in this pathway
BIOCARTA PYK2 PATHWAY	31	24	All SZGR 2.0 genes in this pathway
BIOCARTA MET PATHWAY	37	30	All SZGR 2.0 genes in this pathway
ST DIFFERENTIATION PATHWAY IN PC12 CELLS	45	35	All SZGR 2.0 genes in this pathway
PID MET PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID REELIN PATHWAY	29	29	All SZGR 2.0 genes in this pathway
PID IGF1 PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID IFNG PATHWAY	40	34	All SZGR 2.0 genes in this pathway
PID EPHA FWDPATHWAY	34	29	All SZGR 2.0 genes in this pathway
PID TRKR PATHWAY	62	48	All SZGR 2.0 genes in this pathway
PID TCR JNK PATHWAY	14	11	All SZGR 2.0 genes in this pathway
PID PDGFRA PATHWAY	22	18	All SZGR 2.0 genes in this pathway
PID KIT PATHWAY	52	40	All SZGR 2.0 genes in this pathway
PID EPO PATHWAY	34	29	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY PDGF	122	93	All SZGR 2.0 genes in this pathway
REACTOME DOWNSTREAM SIGNAL TRANSDUCTION	95	76	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ILS	107	86	All SZGR 2.0 genes in this pathway
REACTOME REGULATION OF SIGNALING BY CBL	18	16	All SZGR 2.0 genes in this pathway
REACTOME IL 3 5 AND GM CSF SIGNALING	43	34	All SZGR 2.0 genes in this pathway
REACTOME IMMUNE SYSTEM	933	616	All SZGR 2.0 genes in this pathway
REACTOME CYTOKINE SIGNALING IN IMMUNE SYSTEM	270	204	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS DN	459	276	All SZGR 2.0 genes in this pathway
BIDUS METASTASIS UP	214	134	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA PROGRESSION RISK	74	44	All SZGR 2.0 genes in this pathway
LOCKWOOD AMPLIFIED IN LUNG CANCER	214	139	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 8HR UP	105	73	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV SCC DN	123	86	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
GENTILE RESPONSE CLUSTER D3	61	39	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS DN	120	81	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP	863	514	All SZGR 2.0 genes in this pathway
BOCHKIS FOXA2 TARGETS	425	261	All SZGR 2.0 genes in this pathway
BONCI TARGETS OF MIR15A AND MIR16 1	91	75	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP	442	263	All SZGR 2.0 genes in this pathway
ZEMBUTSU SENSITIVITY TO NIMUSTINE	17	13	All SZGR 2.0 genes in this pathway
KRIEG HYPOXIA NOT VIA KDM3A	770	480	All SZGR 2.0 genes in this pathway
HOLLEMAN PREDNISOLONE RESISTANCE ALL UP	19	15	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-128	3565	3571	m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	3565	3571	m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-15/16/195/424/497	20	26	m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-188	3259	3265	m8	hsa-miR-188	CAUCCCUUGCAUGGUGGAGGGU
miR-200bc/429	3728	3735	1A,m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-204/211	3258	3264	m8	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
miR-204/211	3258	3264	m8	hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-214	18	24	m8	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-224	3738	3744	1A	hsa-miR-224	CAAGUCACUAGUGGUUCCGUUUA
miR-30-5p	3174	3181	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-335	3212	3218	m8	hsa-miR-335^brain	UCAAGAGCAAUAACGAAAAAUGU
miR-96	2612	2619	1A,m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CRKL