Gene Page: CSF1R
Summary ?
| GeneID | 1436 |
| Symbol | CSF1R |
| Synonyms | C-FMS|CD115|CSF-1R|CSFR|FIM2|FMS|HDLS|M-CSF-R |
| Description | colony stimulating factor 1 receptor |
| Reference | MIM:164770|HGNC:HGNC:2433|Ensembl:ENSG00000182578|HPRD:01269|Vega:OTTHUMG00000130050 |
| Gene type | protein-coding |
| Map location | 5q32 |
| Pascal p-value | 0.676 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01718 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00459 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005011 | macrophage colony stimulating factor receptor activity | TAS | 8981357 | |
| GO:0004872 | receptor activity | IEA | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007169 | transmembrane receptor protein tyrosine kinase signaling pathway | IEA | - | |
| GO:0006468 | protein amino acid phosphorylation | IEA | - | |
| GO:0007165 | signal transduction | TAS | 8981357 | |
| GO:0008283 | cell proliferation | TAS | 8981357 | |
| GO:0007275 | multicellular organismal development | TAS | 8981357 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005886 | plasma membrane | TAS | 2421165 | |
| GO:0005887 | integral to plasma membrane | TAS | 2421165 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| CBL | C-CBL | CBL2 | RNF55 | Cas-Br-M (murine) ecotropic retroviral transforming sequence | - | HPRD,BioGRID | 11847211 |
| CSF1 | MCSF | MGC31930 | colony stimulating factor 1 (macrophage) | - | HPRD,BioGRID | 2408759 |8355686 |
| FYN | MGC45350 | SLK | SYN | FYN oncogene related to SRC, FGR, YES | - | HPRD,BioGRID | 7681396 |
| GRAP2 | GADS | GRAP-2 | GRB2L | GRBLG | GRID | GRPL | GrbX | Grf40 | Mona | P38 | GRB2-related adaptor protein 2 | Reconstituted Complex | BioGRID | 9857184 |
| GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | - | HPRD,BioGRID | 8262059 |9178909 |9380408 |
| INPP5D | MGC104855 | MGC142140 | MGC142142 | SHIP | SHIP1 | SIP-145 | hp51CN | inositol polyphosphate-5-phosphatase, 145kDa | CSF1R (c-FMS) interacts with INPP5D. This interaction was modeled on a demonstrated interaction between CSF1R and INPP5D from unspecified species. | BIND | 15735664 |
| INPPL1 | SHIP2 | inositol polyphosphate phosphatase-like 1 | CSF1R (c-FMS) interacts with INPPL1 (SHIP-2). This interaction was modeled on a demonstrated interaction between CSF1R and INPPL1 from unspecified species. | BIND | 15735664 |
| LYN | FLJ26625 | JTK8 | v-yes-1 Yamaguchi sarcoma viral related oncogene homolog | - | HPRD,BioGRID | 7636265 |
| PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | - | HPRD,BioGRID | 8947469 |
| PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | CSF1R (c-FMS) interacts with PIK3R1 (PI3'-k).his interaction was modeled on a demonstrated interaction between CSF1R and PIK3R1 from unspecified species. | BIND | 15735664 |
| PIK3R2 | P85B | p85 | p85-BETA | phosphoinositide-3-kinase, regulatory subunit 2 (beta) | - | HPRD | 1334406 |
| RASA1 | CM-AVM | CMAVM | DKFZp434N071 | GAP | PKWS | RASA | RASGAP | p120GAP | p120RASGAP | RAS p21 protein activator (GTPase activating protein) 1 | - | HPRD,BioGRID | 2172781 |
| SOCS1 | CIS1 | CISH1 | JAB | SOCS-1 | SSI-1 | SSI1 | TIP3 | suppressor of cytokine signaling 1 | - | HPRD,BioGRID | 10022833 |11297560 |
| SOCS1 | CIS1 | CISH1 | JAB | SOCS-1 | SSI-1 | SSI1 | TIP3 | suppressor of cytokine signaling 1 | Socs1 interacts with CSF1-R. This interaction was modeled on a demonstrated interaction between mouse proteins. | BIND | 10022833 |
| SOCS3 | ATOD4 | CIS3 | Cish3 | MGC71791 | SOCS-3 | SSI-3 | SSI3 | suppressor of cytokine signaling 3 | - | HPRD,BioGRID | 12133942 |
| SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | Affinity Capture-Western | BioGRID | 7681396 |
| THOC5 | C22orf19 | Fmip | PK1.3 | fSAP79 | THO complex 5 | - | HPRD | 10597251 |
| YES1 | HsT441 | P61-YES | Yes | c-yes | v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 | - | HPRD,BioGRID | 7681396 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG CYTOKINE CYTOKINE RECEPTOR INTERACTION | 267 | 161 | All SZGR 2.0 genes in this pathway |
| KEGG ENDOCYTOSIS | 183 | 132 | All SZGR 2.0 genes in this pathway |
| KEGG HEMATOPOIETIC CELL LINEAGE | 88 | 60 | All SZGR 2.0 genes in this pathway |
| KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CBL PATHWAY | 13 | 10 | All SZGR 2.0 genes in this pathway |
| BIOCARTA ETS PATHWAY | 18 | 12 | All SZGR 2.0 genes in this pathway |
| PID PTP1B PATHWAY | 52 | 40 | All SZGR 2.0 genes in this pathway |
| PID TCPTP PATHWAY | 43 | 33 | All SZGR 2.0 genes in this pathway |
| PID AVB3 INTEGRIN PATHWAY | 75 | 53 | All SZGR 2.0 genes in this pathway |
| PID CMYB PATHWAY | 84 | 61 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA DN | 116 | 79 | All SZGR 2.0 genes in this pathway |
| DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
| MARKEY RB1 CHRONIC LOF DN | 118 | 78 | All SZGR 2.0 genes in this pathway |
| MARKEY RB1 ACUTE LOF UP | 215 | 137 | All SZGR 2.0 genes in this pathway |
| KLEIN TARGETS OF BCR ABL1 FUSION | 45 | 34 | All SZGR 2.0 genes in this pathway |
| RASHI RESPONSE TO IONIZING RADIATION 6 | 84 | 54 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| FERRANDO TAL1 NEIGHBORS | 21 | 15 | All SZGR 2.0 genes in this pathway |
| NADLER OBESITY UP | 61 | 34 | All SZGR 2.0 genes in this pathway |
| HESS TARGETS OF HOXA9 AND MEIS1 DN | 77 | 48 | All SZGR 2.0 genes in this pathway |
| LENAOUR DENDRITIC CELL MATURATION DN | 128 | 90 | All SZGR 2.0 genes in this pathway |
| HADDAD T LYMPHOCYTE AND NK PROGENITOR DN | 63 | 41 | All SZGR 2.0 genes in this pathway |
| RAMALHO STEMNESS DN | 74 | 55 | All SZGR 2.0 genes in this pathway |
| NIELSEN GIST AND SYNOVIAL SARCOMA DN | 20 | 15 | All SZGR 2.0 genes in this pathway |
| MCLACHLAN DENTAL CARIES DN | 245 | 144 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
| JIANG AGING HYPOTHALAMUS UP | 47 | 31 | All SZGR 2.0 genes in this pathway |
| MCLACHLAN DENTAL CARIES UP | 253 | 147 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
| ZHANG BREAST CANCER PROGENITORS DN | 145 | 93 | All SZGR 2.0 genes in this pathway |
| QI PLASMACYTOMA UP | 259 | 185 | All SZGR 2.0 genes in this pathway |
| VILIMAS NOTCH1 TARGETS DN | 20 | 12 | All SZGR 2.0 genes in this pathway |
| ICHIBA GRAFT VERSUS HOST DISEASE 35D UP | 131 | 79 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| NAKAYAMA SOFT TISSUE TUMORS PCA1 UP | 76 | 46 | All SZGR 2.0 genes in this pathway |
| VISALA AGING LYMPHOCYTE UP | 10 | 7 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| FEVR CTNNB1 TARGETS UP | 682 | 433 | All SZGR 2.0 genes in this pathway |
| RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-155 | 763 | 770 | 1A,m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
| miR-22 | 594 | 601 | 1A,m8 | hsa-miR-22brain | AAGCUGCCAGUUGAAGAACUGU |
| miR-34/449 | 192 | 199 | 1A,m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
| hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
| hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
| hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.