Gene Page: CSNK1D
Summary ?
| GeneID | 1453 |
| Symbol | CSNK1D |
| Synonyms | ASPS|CKIdelta|FASPS2|HCKID |
| Description | casein kinase 1 delta |
| Reference | MIM:600864|HGNC:HGNC:2452|Ensembl:ENSG00000141551|HPRD:02920|Vega:OTTHUMG00000178601 |
| Gene type | protein-coding |
| Map location | 17q25 |
| Pascal p-value | 0.043 |
| Sherlock p-value | 0.286 |
| Fetal beta | 0.681 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.087 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg19496744 | 17 | 80231639 | CSNK1D | 1.92E-5 | -0.289 | 0.016 | DMG:Wockner_2014 |
| cg11439535 | 17 | 80203277 | CSNK1D | 4.55E-5 | 0.484 | 0.021 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs2156215 | chr11 | 78825462 | CSNK1D | 1453 | 0.14 | trans | ||
| rs17064520 | chr18 | 55909629 | CSNK1D | 1453 | 0.16 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| TIMP3 | 0.75 | 0.75 |
| PCDHGC3 | 0.74 | 0.69 |
| CDGAP | 0.74 | 0.76 |
| RHBDF1 | 0.74 | 0.69 |
| SLCO2B1 | 0.73 | 0.79 |
| MMRN2 | 0.73 | 0.77 |
| OLIG1 | 0.72 | 0.65 |
| BGN | 0.72 | 0.75 |
| TNS3 | 0.71 | 0.75 |
| AC020763.2 | 0.71 | 0.70 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| NDUFAF2 | -0.53 | -0.62 |
| FRG1 | -0.52 | -0.59 |
| ZNF32 | -0.52 | -0.61 |
| C8orf59 | -0.51 | -0.63 |
| MTIF3 | -0.50 | -0.56 |
| PPP2R3C | -0.50 | -0.58 |
| C12orf45 | -0.49 | -0.60 |
| CWC15 | -0.48 | -0.56 |
| OXSM | -0.47 | -0.55 |
| C11orf74 | -0.47 | -0.57 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 17353931 | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0004674 | protein serine/threonine kinase activity | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006468 | protein amino acid phosphorylation | IEA | - | |
| GO:0006468 | protein amino acid phosphorylation | TAS | 8786104 | |
| GO:0016055 | Wnt receptor signaling pathway | IEA | - | |
| GO:0006281 | DNA repair | TAS | 8786104 | |
| GO:0007165 | signal transduction | TAS | 8786104 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| AKAP9 | AKAP350 | AKAP450 | CG-NAP | HYPERION | KIAA0803 | MU-RMS-40.16A | PRKA9 | YOTIAO | A kinase (PRKA) anchor protein (yotiao) 9 | - | HPRD,BioGRID | 12270714 |
| ARFGAP1 | ARF1GAP | HRIHFB2281 | MGC39924 | ADP-ribosylation factor GTPase activating protein 1 | - | HPRD | 12181329 |
| DVL1 | DVL | MGC54245 | dishevelled, dsh homolog 1 (Drosophila) | - | HPRD,BioGRID | 11818547 |
| DVL3 | KIAA0208 | dishevelled, dsh homolog 3 (Drosophila) | Two-hybrid | BioGRID | 16189514 |
| GJA1 | CX43 | DFNB38 | GJAL | ODDD | gap junction protein, alpha 1, 43kDa | - | HPRD,BioGRID | 12270943 |
| MCC | DKFZp762O1615 | FLJ38893 | FLJ46755 | MCC1 | mutated in colorectal cancers | Affinity Capture-MS | BioGRID | 17353931 |
| PER1 | MGC88021 | PER | RIGUI | hPER | period homolog 1 (Drosophila) | - | HPRD,BioGRID | 11165242 |
| PER1 | MGC88021 | PER | RIGUI | hPER | period homolog 1 (Drosophila) | CSNK1D (CKI-delta) interacts with and phosphorylates PER1. This interaction was modelled on a demonstrated interaction between human CKI-delta and mouse PER1. | BIND | 15800623 |
| PER2 | FASPS | KIAA0347 | period homolog 2 (Drosophila) | CSNK1D (CKIdelta) interacts with PER2. | BIND | 15800623 |
| PER3 | GIG13 | period homolog 3 (Drosophila) | - | HPRD | 11865049 |
| PER3 | GIG13 | period homolog 3 (Drosophila) | CSNK1D (CKI-delta) interacts with and phosphorylates PER3. | BIND | 15800623 |
| PPP1R14A | CPI-17 | CPI17 | PPP1INL | protein phosphatase 1, regulatory (inhibitor) subunit 14A | - | HPRD | 15003508 |
| TP53 | FLJ92943 | LFS1 | TRP53 | p53 | tumor protein p53 | - | HPRD | 9349507 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG HEDGEHOG SIGNALING PATHWAY | 56 | 42 | All SZGR 2.0 genes in this pathway |
| KEGG GAP JUNCTION | 90 | 68 | All SZGR 2.0 genes in this pathway |
| KEGG CIRCADIAN RHYTHM MAMMAL | 13 | 13 | All SZGR 2.0 genes in this pathway |
| BIOCARTA P35ALZHEIMERS PATHWAY | 11 | 9 | All SZGR 2.0 genes in this pathway |
| BIOCARTA P53HYPOXIA PATHWAY | 23 | 21 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CK1 PATHWAY | 17 | 17 | All SZGR 2.0 genes in this pathway |
| BIOCARTA WNT PATHWAY | 26 | 24 | All SZGR 2.0 genes in this pathway |
| WNT SIGNALING | 89 | 71 | All SZGR 2.0 genes in this pathway |
| PID BETA CATENIN DEG PATHWAY | 18 | 17 | All SZGR 2.0 genes in this pathway |
| PID FOXO PATHWAY | 49 | 43 | All SZGR 2.0 genes in this pathway |
| PID HEDGEHOG GLI PATHWAY | 48 | 35 | All SZGR 2.0 genes in this pathway |
| PID P53 REGULATION PATHWAY | 59 | 50 | All SZGR 2.0 genes in this pathway |
| REACTOME CELL CYCLE | 421 | 253 | All SZGR 2.0 genes in this pathway |
| REACTOME CELL CYCLE MITOTIC | 325 | 185 | All SZGR 2.0 genes in this pathway |
| REACTOME RECRUITMENT OF MITOTIC CENTROSOME PROTEINS AND COMPLEXES | 66 | 43 | All SZGR 2.0 genes in this pathway |
| REACTOME LOSS OF NLP FROM MITOTIC CENTROSOMES | 59 | 38 | All SZGR 2.0 genes in this pathway |
| REACTOME MITOTIC G2 G2 M PHASES | 81 | 50 | All SZGR 2.0 genes in this pathway |
| REACTOME CIRCADIAN CLOCK | 53 | 40 | All SZGR 2.0 genes in this pathway |
| NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN | 634 | 384 | All SZGR 2.0 genes in this pathway |
| WATANABE RECTAL CANCER RADIOTHERAPY RESPONSIVE UP | 108 | 67 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS BASAL UP | 380 | 215 | All SZGR 2.0 genes in this pathway |
| BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
| NAGASHIMA NRG1 SIGNALING UP | 176 | 123 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS UP | 214 | 155 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| MARKEY RB1 ACUTE LOF UP | 215 | 137 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
| RASHI RESPONSE TO IONIZING RADIATION 4 | 61 | 34 | All SZGR 2.0 genes in this pathway |
| DIRMEIER LMP1 RESPONSE LATE UP | 57 | 41 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
| KAUFFMANN DNA REPAIR GENES | 230 | 137 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON | 335 | 181 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY MUTATED AND AMPLIFIED IN BREAST CANCER | 94 | 60 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL | 254 | 164 | All SZGR 2.0 genes in this pathway |
| LEE AGING NEOCORTEX UP | 89 | 59 | All SZGR 2.0 genes in this pathway |
| VARELA ZMPSTE24 TARGETS UP | 40 | 30 | All SZGR 2.0 genes in this pathway |
| BILD HRAS ONCOGENIC SIGNATURE | 261 | 166 | All SZGR 2.0 genes in this pathway |
| DOUGLAS BMI1 TARGETS DN | 314 | 188 | All SZGR 2.0 genes in this pathway |
| ZHANG BREAST CANCER PROGENITORS DN | 145 | 93 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| SHEDDEN LUNG CANCER POOR SURVIVAL A6 | 456 | 285 | All SZGR 2.0 genes in this pathway |
| BOYAULT LIVER CANCER SUBCLASS G3 UP | 188 | 121 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
| MARSON FOXP3 TARGETS UP | 66 | 43 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
| ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF | 222 | 159 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-185 | 115 | 121 | 1A | hsa-miR-185brain | UGGAGAGAAAGGCAGUUC |
| miR-194 | 50 | 56 | m8 | hsa-miR-194 | UGUAACAGCAACUCCAUGUGGA |
| miR-27 | 16 | 22 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-33 | 30 | 36 | m8 | hsa-miR-33 | GUGCAUUGUAGUUGCAUUG |
| hsa-miR-33b | GUGCAUUGCUGUUGCAUUGCA | ||||
| miR-346 | 24 | 31 | 1A,m8 | hsa-miR-346brain | UGUCUGCCCGCAUGCCUGCCUCU |
| miR-543 | 98 | 104 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.