Gene Page: ADRA2C
Summary ?
| GeneID | 152 |
| Symbol | ADRA2C |
| Synonyms | ADRA2L2|ADRA2RL2|ADRARL2|ALPHA2CAR |
| Description | adrenoceptor alpha 2C |
| Reference | MIM:104250|HGNC:HGNC:283|Ensembl:ENSG00000184160|HPRD:00085|Vega:OTTHUMG00000159830 |
| Gene type | protein-coding |
| Map location | 4p16 |
| Pascal p-value | 0.049 |
| Sherlock p-value | 0.002 |
| Fetal beta | -0.685 |
| eGene | Cerebellum Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| ADT:Sun_2012 | Systematic Investigation of Antipsychotic Drugs and Their Targets | A total of 382 drug-target associations involving 43 antipsychotic drugs and 49 target genes. | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenics,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs11186955 | chr10 | 94138670 | ADRA2C | 152 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004872 | receptor activity | IEA | - | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0004938 | alpha2-adrenergic receptor activity | TAS | 9371698 | |
| GO:0004935 | adrenoceptor activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000187 | activation of MAPK activity | TAS | 10196213 | |
| GO:0007186 | G-protein coupled receptor protein signaling pathway | TAS | 9371698 | |
| GO:0007267 | cell-cell signaling | TAS | 9371698 | |
| GO:0007165 | signal transduction | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005768 | endosome | TAS | 10196213 | |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0005887 | integral to plasma membrane | TAS | 9371698 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
| DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS D UP | 38 | 23 | All SZGR 2.0 genes in this pathway |
| HAMAI APOPTOSIS VIA TRAIL DN | 186 | 107 | All SZGR 2.0 genes in this pathway |
| LIN APC TARGETS | 77 | 55 | All SZGR 2.0 genes in this pathway |
| HANSON HRAS SIGNALING VIA NFKB | 22 | 14 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS DN | 105 | 63 | All SZGR 2.0 genes in this pathway |
| WALLACE PROSTATE CANCER RACE UP | 299 | 167 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 3D UP | 210 | 124 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| VALK AML CLUSTER 13 | 30 | 20 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
| STEIN ESRRA TARGETS | 535 | 325 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 6 | 75 | 48 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-182 | 472 | 479 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
| miR-96 | 473 | 479 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.