SZGR2

Summary ?

GeneID	1745
Symbol	DLX1
Synonyms	-
Description	distal-less homeobox 1
Reference	MIM:600029\|HGNC:HGNC:2914\|Ensembl:ENSG00000144355\|HPRD:08961\|Vega:OTTHUMG00000073951
Gene type	protein-coding
Map location	2q32
Pascal p-value	2.554E-5
Sherlock p-value	0.613
Fetal beta	0.729
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg13372879	2	172948073	DLX1	4.04E-10	-0.012	7.69E-7	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs1387353	chr1	164414740	DLX1	1745		0.07		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SLC44A2	0.70	0.71
KIAA1161	0.68	0.75
GPT2	0.68	0.74
LTBP3	0.66	0.66
PCDHGC3	0.65	0.71
PPAP2B	0.64	0.65
SOX21	0.64	0.65
PEX10	0.64	0.65
TTC38	0.64	0.68
PLXNB1	0.63	0.64

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AL050337.1	-0.32	-0.29
AF347015.21	-0.30	-0.24
SYCP3	-0.30	-0.24
FAM159B	-0.29	-0.30
NOX1	-0.28	-0.24
AC021914.1	-0.26	-0.14
ZBTB8OS	-0.25	-0.23
SEC62	-0.25	-0.30
C17orf84	-0.25	-0.06
AC093616.2	-0.24	-0.21

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003677	DNA binding	IEA		-
GO:0003682	chromatin binding	IEA		-
GO:0003700	transcription factor activity	IEA		-
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0043524	negative regulation of neuron apoptosis	IEA	neuron (GO term level: 9)	-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0007275	multicellular organismal development	NAS		-
GO:0030154	cell differentiation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005634	nucleus	NAS		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PID SMAD2 3NUCLEAR PATHWAY	82	63	All SZGR 2.0 genes in this pathway
WANG LMO4 TARGETS UP	372	227	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN	329	219	All SZGR 2.0 genes in this pathway
COLDREN GEFITINIB RESISTANCE UP	85	57	All SZGR 2.0 genes in this pathway
MARKEY RB1 ACUTE LOF DN	228	137	All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER A	100	63	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
SHEPARD BMYB MORPHOLINO DN	200	112	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS DN	593	372	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE UP	578	341	All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN	940	425	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN	374	217	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-19	1163	1169	1A	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	1163	1169	1A	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-23	1262	1268	m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	1262	1268	m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-323	1262	1268	1A	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-330	1340	1346	m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-330	1340	1346	m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-376c	1298	1304	m8	hsa-miR-376c	AACAUAGAGGAAAUUCCACG
miR-378	317	323	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-543	1326	1333	1A,m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DLX1