Gene Page: DLX1
Summary ?
GeneID | 1745 |
Symbol | DLX1 |
Synonyms | - |
Description | distal-less homeobox 1 |
Reference | MIM:600029|HGNC:HGNC:2914|Ensembl:ENSG00000144355|HPRD:08961|Vega:OTTHUMG00000073951 |
Gene type | protein-coding |
Map location | 2q32 |
Pascal p-value | 2.554E-5 |
Sherlock p-value | 0.613 |
Fetal beta | 0.729 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg13372879 | 2 | 172948073 | DLX1 | 4.04E-10 | -0.012 | 7.69E-7 | DMG:Jaffe_2016 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1387353 | chr1 | 164414740 | DLX1 | 1745 | 0.07 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SLC44A2 | 0.70 | 0.71 |
KIAA1161 | 0.68 | 0.75 |
GPT2 | 0.68 | 0.74 |
LTBP3 | 0.66 | 0.66 |
PCDHGC3 | 0.65 | 0.71 |
PPAP2B | 0.64 | 0.65 |
SOX21 | 0.64 | 0.65 |
PEX10 | 0.64 | 0.65 |
TTC38 | 0.64 | 0.68 |
PLXNB1 | 0.63 | 0.64 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AL050337.1 | -0.32 | -0.29 |
AF347015.21 | -0.30 | -0.24 |
SYCP3 | -0.30 | -0.24 |
FAM159B | -0.29 | -0.30 |
NOX1 | -0.28 | -0.24 |
AC021914.1 | -0.26 | -0.14 |
ZBTB8OS | -0.25 | -0.23 |
SEC62 | -0.25 | -0.30 |
C17orf84 | -0.25 | -0.06 |
AC093616.2 | -0.24 | -0.21 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003677 | DNA binding | IEA | - | |
GO:0003682 | chromatin binding | IEA | - | |
GO:0003700 | transcription factor activity | IEA | - | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0043524 | negative regulation of neuron apoptosis | IEA | neuron (GO term level: 9) | - |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0007275 | multicellular organismal development | NAS | - | |
GO:0030154 | cell differentiation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0005634 | nucleus | NAS | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID SMAD2 3NUCLEAR PATHWAY | 82 | 63 | All SZGR 2.0 genes in this pathway |
WANG LMO4 TARGETS UP | 372 | 227 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
COLDREN GEFITINIB RESISTANCE UP | 85 | 57 | All SZGR 2.0 genes in this pathway |
MARKEY RB1 ACUTE LOF DN | 228 | 137 | All SZGR 2.0 genes in this pathway |
RICKMAN HEAD AND NECK CANCER A | 100 | 63 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
SHEPARD BMYB MORPHOLINO DN | 200 | 112 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN | 374 | 217 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-19 | 1163 | 1169 | 1A | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-23 | 1262 | 1268 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-323 | 1262 | 1268 | 1A | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
miR-330 | 1340 | 1346 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA | ||||
miR-376c | 1298 | 1304 | m8 | hsa-miR-376c | AACAUAGAGGAAAUUCCACG |
miR-378 | 317 | 323 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
miR-543 | 1326 | 1333 | 1A,m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.