Gene Page: DTX1
Summary ?
| GeneID | 1840 |
| Symbol | DTX1 |
| Synonyms | hDx-1 |
| Description | deltex 1 |
| Reference | MIM:602582|HGNC:HGNC:3060|Ensembl:ENSG00000135144|HPRD:03991|Vega:OTTHUMG00000169610 |
| Gene type | protein-coding |
| Map location | 12q24.13 |
| Pascal p-value | 0.342 |
| TADA p-value | 0.015 |
| Fetal beta | 0.233 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
| Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| DNM:Gulsuner_2013 | Whole Exome Sequencing analysis | 155 DNMs identified by exome sequencing of quads or trios of schizophrenia individuals and their parents. | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| DTX1 | chr12 | 113496202 | C | G | NM_004416 | p.69L>V | missense | Schizophrenia | DNM:Gulsuner_2013 |
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg11787160 | 12 | 113515332 | DTX1 | 3.321E-4 | 0.488 | 0.041 | DMG:Wockner_2014 |
| cg18567954 | 12 | 113496168 | DTX1 | 3.708E-4 | 0.499 | 0.043 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs4467164 | chr18 | 75123435 | DTX1 | 1840 | 0.2 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| THRA | 0.70 | 0.78 |
| ANKDD1A | 0.70 | 0.74 |
| GDF9 | 0.69 | 0.66 |
| AC100793.2 | 0.69 | 0.69 |
| CHRNB4 | 0.69 | 0.70 |
| CUL7 | 0.69 | 0.72 |
| ZNF446 | 0.68 | 0.74 |
| ZNF185 | 0.68 | 0.71 |
| PLSCR3 | 0.68 | 0.69 |
| GTF2H4 | 0.68 | 0.71 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.27 | -0.52 | -0.66 |
| MT-CO2 | -0.50 | -0.65 |
| S100B | -0.50 | -0.63 |
| AF347015.33 | -0.49 | -0.64 |
| C5orf53 | -0.49 | -0.58 |
| AF347015.31 | -0.49 | -0.63 |
| AF347015.8 | -0.49 | -0.65 |
| CA4 | -0.48 | -0.58 |
| CD8BP | -0.48 | -0.67 |
| MT-CYB | -0.47 | -0.62 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003713 | transcription coactivator activity | TAS | 9590294 | |
| GO:0005112 | Notch binding | IDA | 11564735 | |
| GO:0005515 | protein binding | IPI | 7671825 | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0017124 | SH3 domain binding | IEA | - | |
| GO:0030528 | transcription regulator activity | NAS | 11564735 | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0045665 | negative regulation of neuron differentiation | IGI | neuron (GO term level: 10) | 11564735 |
| GO:0010001 | glial cell differentiation | IEA | Glial (GO term level: 8) | - |
| GO:0006366 | transcription from RNA polymerase II promoter | TAS | 9590294 | |
| GO:0008593 | regulation of Notch signaling pathway | IGI | 11564735 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005737 | cytoplasm | TAS | 9590294 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG NOTCH SIGNALING PATHWAY | 47 | 35 | All SZGR 2.0 genes in this pathway |
| PID NOTCH PATHWAY | 59 | 49 | All SZGR 2.0 genes in this pathway |
| PID PS1 PATHWAY | 46 | 39 | All SZGR 2.0 genes in this pathway |
| REACTOME ACTIVATED NOTCH1 TRANSMITS SIGNAL TO THE NUCLEUS | 27 | 18 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY NOTCH1 | 70 | 46 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY NOTCH | 103 | 64 | All SZGR 2.0 genes in this pathway |
| MORI PRE BI LYMPHOCYTE DN | 77 | 49 | All SZGR 2.0 genes in this pathway |
| MORI LARGE PRE BII LYMPHOCYTE DN | 58 | 39 | All SZGR 2.0 genes in this pathway |
| MORI IMMATURE B LYMPHOCYTE UP | 53 | 35 | All SZGR 2.0 genes in this pathway |
| MORI PLASMA CELL DN | 33 | 20 | All SZGR 2.0 genes in this pathway |
| SANSOM APC TARGETS DN | 366 | 238 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA CD2 UP | 45 | 32 | All SZGR 2.0 genes in this pathway |
| RAY TUMORIGENESIS BY ERBB2 CDC25A UP | 104 | 57 | All SZGR 2.0 genes in this pathway |
| BOYLAN MULTIPLE MYELOMA D UP | 89 | 62 | All SZGR 2.0 genes in this pathway |
| VILIMAS NOTCH1 TARGETS UP | 52 | 41 | All SZGR 2.0 genes in this pathway |
| MARSHALL VIRAL INFECTION RESPONSE DN | 29 | 21 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
| LI INDUCED T TO NATURAL KILLER DN | 116 | 83 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-128 | 1052 | 1058 | m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
| hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
| miR-138 | 957 | 963 | m8 | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
| miR-204/211 | 1010 | 1016 | m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
| hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.