Gene Page: EPHA2
Summary ?
GeneID | 1969 |
Symbol | EPHA2 |
Synonyms | ARCC2|CTPA|CTPP1|CTRCT6|ECK |
Description | EPH receptor A2 |
Reference | MIM:176946|HGNC:HGNC:3386|Ensembl:ENSG00000142627|HPRD:01494|Vega:OTTHUMG00000009527 |
Gene type | protein-coding |
Map location | 1p36 |
Pascal p-value | 0.22 |
TADA p-value | 0.004 |
Fetal beta | 0.016 |
eGene | Myers' cis & trans |
Support | CompositeSet |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:Fromer_2014 | Whole Exome Sequencing analysis | This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA. | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
EPHA2 | chr1 | 16458218..16458219 | CG | C | NM_004431 NM_004431 | . . | splice frameshift | Schizophrenia | DNM:Fromer_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs2746486 | chr1 | 17465173 | EPHA2 | 1969 | 0.19 | cis |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
PSMA7 | 0.93 | 0.95 |
PSMD13 | 0.91 | 0.92 |
RUVBL2 | 0.90 | 0.93 |
CCT7 | 0.90 | 0.90 |
EIF6 | 0.90 | 0.94 |
RRP9 | 0.89 | 0.90 |
DCTPP1 | 0.89 | 0.92 |
WIBG | 0.89 | 0.90 |
CFL1 | 0.89 | 0.90 |
C19orf10 | 0.89 | 0.92 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.8 | -0.75 | -0.76 |
AF347015.33 | -0.75 | -0.77 |
AF347015.27 | -0.74 | -0.77 |
AF347015.15 | -0.74 | -0.77 |
MT-CYB | -0.74 | -0.76 |
MT-CO2 | -0.74 | -0.72 |
AF347015.2 | -0.73 | -0.75 |
AF347015.26 | -0.73 | -0.78 |
AF347015.31 | -0.72 | -0.72 |
AF347015.9 | -0.67 | -0.73 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0004872 | receptor activity | IEA | - | |
GO:0005003 | ephrin receptor activity | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0030182 | neuron differentiation | IEA | neuron (GO term level: 8) | - |
GO:0006468 | protein amino acid phosphorylation | IEA | - | |
GO:0007165 | signal transduction | TAS | 2174105 | |
GO:0048013 | ephrin receptor signaling pathway | IEA | - | |
GO:0007275 | multicellular organismal development | TAS | 7918100 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | TAS | 2174105 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ACP1 | HAAP | MGC111030 | MGC3499 | acid phosphatase 1, soluble | - | HPRD,BioGRID | 12167657 |
EFNA1 | B61 | ECKLG | EFL1 | EPLG1 | LERK1 | TNFAIP4 | ephrin-A1 | The membrane bound ligand B61 interacts with the receptor ECK. This interaction was modeled on a demonstrated interaction between B61 from human and ECK from mouse. | BIND | 7973638 |8755474 |
EFNA1 | B61 | ECKLG | EFL1 | EPLG1 | LERK1 | TNFAIP4 | ephrin-A1 | - | HPRD | 7973638 |8755474 |
EFNA2 | ELF-1 | EPLG6 | HEK7-L | LERK6 | ephrin-A2 | - | HPRD | 8755474 |
EFNA3 | EFL2 | EPLG3 | Ehk1-L | LERK3 | ephrin-A3 | The membrane bound ligand EHK1-L interacts with the receptor ECK. This interaction was modeled on a demonstrated interaction between EHK1-L from human and ECK from mouse. | BIND | 7973638 |8755474 |
EFNA3 | EFL2 | EPLG3 | Ehk1-L | LERK3 | ephrin-A3 | - | HPRD | 12907451 |
EFNA4 | EFL4 | EPLG4 | LERK4 | MGC125826 | ephrin-A4 | - | HPRD | 10607706 |
EFNA4 | EFL4 | EPLG4 | LERK4 | MGC125826 | ephrin-A4 | - | HPRD | 8755474 |10607706 |
EFNA5 | AF1 | EFL5 | EPLG7 | GLC1M | LERK7 | RAGS | ephrin-A5 | - | HPRD | 9245480 |
GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | - | HPRD,BioGRID | 12400011 |
PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 7982920 |
PTK2 | FADK | FAK | FAK1 | pp125FAK | PTK2 protein tyrosine kinase 2 | - | HPRD,BioGRID | 10655584 |
PTPN11 | BPTP3 | CFC | MGC14433 | NS1 | PTP-1D | PTP2C | SH-PTP2 | SH-PTP3 | SHP2 | protein tyrosine phosphatase, non-receptor type 11 | Affinity Capture-Western | BioGRID | 10655584 |
SHC1 | FLJ26504 | SHC | SHCA | SHC (Src homology 2 domain containing) transforming protein 1 | - | HPRD,BioGRID | 12400011 |
SLA | SLA1 | SLAP | Src-like-adaptor | - | HPRD,BioGRID | 7543898 |
TNFAIP1 | B12 | B61 | EDP1 | MGC2317 | tumor necrosis factor, alpha-induced protein 1 (endothelial) | - | HPRD | 7536959 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
PID ARF6 PATHWAY | 35 | 27 | All SZGR 2.0 genes in this pathway |
PID P53 DOWNSTREAM PATHWAY | 137 | 94 | All SZGR 2.0 genes in this pathway |
PID EPHA FWDPATHWAY | 34 | 29 | All SZGR 2.0 genes in this pathway |
PID ECADHERIN STABILIZATION PATHWAY | 42 | 34 | All SZGR 2.0 genes in this pathway |
PID EPHA2 FWD PATHWAY | 19 | 16 | All SZGR 2.0 genes in this pathway |
LIU PROSTATE CANCER DN | 481 | 290 | All SZGR 2.0 genes in this pathway |
FOURNIER ACINAR DEVELOPMENT LATE DN | 21 | 13 | All SZGR 2.0 genes in this pathway |
KOBAYASHI EGFR SIGNALING 6HR DN | 18 | 13 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS UP | 290 | 177 | All SZGR 2.0 genes in this pathway |
LEE NEURAL CREST STEM CELL DN | 118 | 79 | All SZGR 2.0 genes in this pathway |
NAGASHIMA NRG1 SIGNALING UP | 176 | 123 | All SZGR 2.0 genes in this pathway |
NAGASHIMA EGF SIGNALING UP | 58 | 40 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS UP | 214 | 155 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE EPIDERMIS DN | 508 | 354 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA FOREVER DN | 31 | 23 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
BEGUM TARGETS OF PAX3 FOXO1 FUSION DN | 45 | 34 | All SZGR 2.0 genes in this pathway |
SCHAVOLT TARGETS OF TP53 AND TP63 | 16 | 12 | All SZGR 2.0 genes in this pathway |
WANG METHYLATED IN BREAST CANCER | 35 | 25 | All SZGR 2.0 genes in this pathway |
FURUKAWA DUSP6 TARGETS PCI35 DN | 74 | 40 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN | 637 | 377 | All SZGR 2.0 genes in this pathway |
ROPERO HDAC2 TARGETS | 114 | 71 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 120 HELA | 69 | 47 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 120 MCF10A | 43 | 28 | All SZGR 2.0 genes in this pathway |
SMITH TERT TARGETS UP | 145 | 91 | All SZGR 2.0 genes in this pathway |
AFFAR YY1 TARGETS UP | 214 | 133 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 16HR UP | 225 | 139 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS DN | 371 | 218 | All SZGR 2.0 genes in this pathway |
MAHAJAN RESPONSE TO IL1A DN | 76 | 57 | All SZGR 2.0 genes in this pathway |
VERRECCHIA RESPONSE TO TGFB1 C5 | 21 | 11 | All SZGR 2.0 genes in this pathway |
VERRECCHIA DELAYED RESPONSE TO TGFB1 | 39 | 26 | All SZGR 2.0 genes in this pathway |
CHEN PDGF TARGETS | 19 | 9 | All SZGR 2.0 genes in this pathway |
JACKSON DNMT1 TARGETS UP | 77 | 57 | All SZGR 2.0 genes in this pathway |
BILD E2F3 ONCOGENIC SIGNATURE | 246 | 153 | All SZGR 2.0 genes in this pathway |
BILD HRAS ONCOGENIC SIGNATURE | 261 | 166 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN | 274 | 165 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
RAY TUMORIGENESIS BY ERBB2 CDC25A DN | 159 | 105 | All SZGR 2.0 genes in this pathway |
HUANG DASATINIB RESISTANCE UP | 81 | 53 | All SZGR 2.0 genes in this pathway |
FIRESTEIN CTNNB1 PATHWAY | 33 | 23 | All SZGR 2.0 genes in this pathway |
VART KSHV INFECTION ANGIOGENIC MARKERS DN | 138 | 92 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER ESR1 DN | 240 | 153 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
FOURNIER ACINAR DEVELOPMENT LATE 2 | 277 | 172 | All SZGR 2.0 genes in this pathway |
CAIRO HEPATOBLASTOMA DN | 267 | 160 | All SZGR 2.0 genes in this pathway |
DORN ADENOVIRUS INFECTION 12HR UP | 29 | 18 | All SZGR 2.0 genes in this pathway |
DORN ADENOVIRUS INFECTION 24HR DN | 43 | 32 | All SZGR 2.0 genes in this pathway |
DORN ADENOVIRUS INFECTION 32HR DN | 39 | 28 | All SZGR 2.0 genes in this pathway |
DORN ADENOVIRUS INFECTION 48HR DN | 40 | 29 | All SZGR 2.0 genes in this pathway |
MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR DN | 36 | 19 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR DN | 88 | 59 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE UP | 242 | 159 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 3 DN | 42 | 24 | All SZGR 2.0 genes in this pathway |
FIGUEROA AML METHYLATION CLUSTER 4 DN | 15 | 9 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP | 259 | 159 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 1 | 46 | 33 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
PHONG TNF TARGETS UP | 63 | 43 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
ZWANG CLASS 3 TRANSIENTLY INDUCED BY EGF | 222 | 159 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 472 | 478 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-141/200a | 754 | 761 | 1A,m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-224 | 833 | 839 | 1A | hsa-miR-224 | CAAGUCACUAGUGGUUCCGUUUA |
miR-26 | 36 | 43 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-93.hd/291-3p/294/295/302/372/373/520 | 223 | 230 | 1A,m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.