SZGR2

Summary ?

GeneID	1995
Symbol	ELAVL3
Synonyms	HUC\|HUCL\|PLE21
Description	ELAV like neuron-specific RNA binding protein 3
Reference	MIM:603458\|HGNC:HGNC:3314\|Ensembl:ENSG00000196361\|HPRD:16024\|Vega:OTTHUMG00000182030
Gene type	protein-coding
Map location	19p13.2
Pascal p-value	0.54
Sherlock p-value	0.94
Fetal beta	0.75
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg06808897	19	11590688	ELAVL3	4.25E-9	-0.015	2.55E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs16888392	chr6	57076551	ELAVL3	1995		0.2		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MRPS2	0.93	0.93
GNB2	0.91	0.92
SCAMP3	0.91	0.90
AIMP2	0.90	0.91
DULLARD	0.90	0.92
LRRC41	0.89	0.90
PTOV1	0.89	0.94
YIPF3	0.89	0.91
UNC119	0.89	0.89
HTRA2	0.89	0.88

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MT-CO2	-0.75	-0.83
AF347015.8	-0.75	-0.85
AF347015.27	-0.75	-0.84
AF347015.33	-0.74	-0.82
MT-CYB	-0.73	-0.82
AF347015.31	-0.73	-0.80
AF347015.15	-0.72	-0.82
AF347015.26	-0.71	-0.84
AF347015.2	-0.71	-0.82
AF347015.21	-0.69	-0.82

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003723	RNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007399	nervous system development	IEA	neurite (GO term level: 5)	-
GO:0007275	multicellular organismal development	IEA		-
GO:0030154	cell differentiation	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ZHOU INFLAMMATORY RESPONSE FIMA DN	284	156	All SZGR 2.0 genes in this pathway
PEREZ TP63 TARGETS	355	243	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN	164	111	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR DN	57	45	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST UP	398	262	All SZGR 2.0 genes in this pathway
FERRANDO T ALL WITH MLL ENL FUSION UP	87	67	All SZGR 2.0 genes in this pathway
MA MYELOID DIFFERENTIATION UP	39	29	All SZGR 2.0 genes in this pathway
RORIE TARGETS OF EWSR1 FLI1 FUSION DN	30	23	All SZGR 2.0 genes in this pathway
JEPSEN SMRT TARGETS	33	23	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN UP	181	112	All SZGR 2.0 genes in this pathway
HANN RESISTANCE TO BCL2 INHIBITOR UP	36	24	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3	349	234	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP A	898	516	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-10	146	152	m8	hsa-miR-10a	UACCCUGUAGAUCCGAAUUUGUG
miR-10	146	152	m8	hsa-miR-10b	UACCCUGUAGAACCGAAUUUGU
miR-129-5p	669	675	1A	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
				hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
				hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
				hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-204/211	606	613	1A,m8	hsa-miR-204^brain	UUCCCUUUGUCAUCCUAUGCCU
miR-204/211	606	613	1A,m8	hsa-miR-211	UUCCCUUUGUCAUCCUUCGCCU
miR-26	651	657	1A	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	651	657	1A	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-30-5p	713	719	m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ELAVL3