SZGR2

Summary ?

GeneID	2018
Symbol	EMX2
Synonyms	-
Description	empty spiracles homeobox 2
Reference	MIM:600035\|HGNC:HGNC:3341\|Ensembl:ENSG00000170370\|HPRD:02495\|Vega:OTTHUMG00000019123
Gene type	protein-coding
Map location	10q26.1
Pascal p-value	0.938
Sherlock p-value	0.023
Fetal beta	0.911
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg20038591	10	119306659	EMX2	1.234E-4	-0.4	0.03	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs4846033	chr1	11788563	EMX2	2018	0.17	trans
rs11582961	chr1	184023058	EMX2	2018	0.11	trans
rs10926019	chr1	240095802	EMX2	2018	0.12	trans
rs17620480	chr6	16035381	EMX2	2018	0.13	trans
rs11008425	chr10	31534410	EMX2	2018	0.01	trans
rs2068673	chr12	60333402	EMX2	2018	0.13	trans
rs6494052	chr15	59295924	EMX2	2018	0.17	trans
rs17070904	chr18	60917055	EMX2	2018	0.07	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CREBBP	0.98	0.98
TRRAP	0.98	0.98
INSR	0.97	0.98
C11orf30	0.97	0.96
ARID1A	0.97	0.97
EP400	0.97	0.97
ZZEF1	0.97	0.97
POGZ	0.96	0.97
SEC16A	0.96	0.97
GATAD2B	0.96	0.95

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.70	-0.84
MT-CO2	-0.69	-0.84
FXYD1	-0.68	-0.82
IFI27	-0.68	-0.81
C5orf53	-0.68	-0.73
S100B	-0.68	-0.79
HIGD1B	-0.67	-0.84
AF347015.27	-0.67	-0.80
SERPINB6	-0.66	-0.70
AF347015.33	-0.66	-0.77

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IEA		-
GO:0005515	protein binding	IPI		15247416
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030182	neuron differentiation	IEA	neuron (GO term level: 8)	-
GO:0030900	forebrain development	IEA	Brain (GO term level: 8)	-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0009952	anterior/posterior pattern formation	IEA		-
GO:0007275	multicellular organismal development	NAS		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	NAS		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
LEE NEURAL CREST STEM CELL DN	118	79	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BROWN MYELOID CELL DEVELOPMENT DN	129	86	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
LEIN ASTROCYTE MARKERS	42	35	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS UP	170	107	All SZGR 2.0 genes in this pathway
BUCKANOVICH T LYMPHOCYTE HOMING ON TUMOR DN	24	16	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
WINNEPENNINCKX MELANOMA METASTASIS DN	46	26	All SZGR 2.0 genes in this pathway
NAKAYAMA SOFT TISSUE TUMORS PCA1 DN	74	47	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP	857	456	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-130/301	498	504	m8	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-148/152	1123	1129	1A	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-19	497	503	m8	hsa-miR-19a	UGUGCAAAUCUAUGCAAAACUGA
miR-19	497	503	m8	hsa-miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-22	253	259	m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-339	47	54	1A,m8	hsa-miR-339	UCCCUGUCCUCCAGGAGCUCA
miR-370	822	828	1A	hsa-miR-370^brain	GCCUGCUGGGGUGGAACCUGG
miR-495	1228	1234	1A	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: EMX2