SZGR2

Summary ?

GeneID	2020
Symbol	EN2
Synonyms	-
Description	engrailed homeobox 2
Reference	MIM:131310\|HGNC:HGNC:3343\|Ensembl:ENSG00000164778\|HPRD:08836\|Vega:OTTHUMG00000151354
Gene type	protein-coding
Map location	7q36
Pascal p-value	0.158
Fetal beta	-0.581
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 3

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg12242086	7	155252796	EN2	2.711E-4	0.514	0.038	DMG:Wockner_2014
cg09134794	7	155252701	EN2	4.551E-4	0.75	0.045	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs16829545	chr2	151977407	EN2	2020	3.662E-8	trans
rs7584986	chr2	184111432	EN2	2020	9.639E-4	trans
rs170776	chr4	173276735	EN2	2020	0.15	trans
rs1396222	chr4	173279496	EN2	2020	0.09	trans
rs335993	chr4	173321789	EN2	2020	0.12	trans
rs10491487	chr5	80323367	EN2	2020	0.01	trans
rs6996695	chr8	77540580	EN2	2020	0.16	trans
rs11139334	chr9	84209393	EN2	2020	0.05	trans
rs7111644	chr11	93300259	EN2	2020	0.13	trans
rs16955618	chr15	29937543	EN2	2020	7.926E-8	trans
rs16945437	chr17	11797650	EN2	2020	0.16	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
CNOT6	0.96	0.93
ATAD2B	0.95	0.88
PBRM1	0.95	0.93
ARID2	0.95	0.93
MED1	0.94	0.93
IGF2BP3	0.94	0.77
MBTD1	0.94	0.92
CASP2	0.94	0.92
MYST3	0.94	0.92
ZNF445	0.94	0.92

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C5orf53	-0.70	-0.76
PTH1R	-0.69	-0.76
LHPP	-0.69	-0.62
HLA-F	-0.68	-0.73
AIFM3	-0.68	-0.73
ALDOC	-0.68	-0.68
FBXO2	-0.68	-0.65
TNFSF12	-0.67	-0.69
SLC16A11	-0.67	-0.69
AF347015.31	-0.66	-0.88

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IEA		-
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0048666	neuron development	IEA	neuron (GO term level: 9)	-
GO:0030902	hindbrain development	IEA	Brain (GO term level: 8)	-
GO:0030901	midbrain development	IEA	Brain (GO term level: 8)	-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0007275	multicellular organismal development	TAS		1672471
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP	292	168	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN	185	111	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP	240	152	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR	681	420	All SZGR 2.0 genes in this pathway
LEIN CEREBELLUM MARKERS	85	47	All SZGR 2.0 genes in this pathway
KONDO PROSTATE CANCER HCP WITH H3K27ME3	97	72	All SZGR 2.0 genes in this pathway
KONDO PROSTATE CANCER WITH H3K27ME3	196	93	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A4	196	124	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP	857	456	All SZGR 2.0 genes in this pathway
VANDESLUIS COMMD1 TARGETS GROUP 3 DN	39	21	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-103/107	384	390	1A	hsa-miR-103^brain	AGCAGCAUUGUACAGGGCUAUGA
miR-103/107	384	390	1A	hsa-miR-107^brain	AGCAGCAUUGUACAGGGCUAUCA
miR-124.1	1754	1761	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	1754	1760	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	1754	1760	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-128	400	406	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	400	406	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-138	86	92	1A	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-181	2024	2030	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-193	66	72	m8	hsa-miR-193a	AACUGGCCUACAAAGUCCCAG
miR-193	66	72	m8	hsa-miR-193b	AACUGGCCCUCAAAGUCCCGCUUU
miR-203.1	389	395	1A	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-25/32/92/363/367	43	49	1A	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-27	400	407	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	400	407	1A,m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-28	418	425	1A,m8	hsa-miR-28^brain	AAGGAGCUCACAGUCUAUUGAG
miR-33	40	47	1A,m8	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	40	47	1A,m8	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-370	1912	1918	1A	hsa-miR-370^brain	GCCUGCUGGGGUGGAACCUGG
miR-376c	136	143	1A,m8	hsa-miR-376c	AACAUAGAGGAAAUUCCACG
miR-378*	365	372	1A,m8	hsa-miR-422b	CUGGACUUGGAGUCAGAAGGCC
miR-378*	365	372	1A,m8	hsa-miR-422a	CUGGACUUAGGGUCAGAAGGCC
miR-382	354	360	m8	hsa-miR-382^brain	GAAGUUGUUCGUGGUGGAUUCG
miR-543	2025	2031	m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU
miR-9	369	375	1A	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: EN2