Summary ?
GeneID219743
SymbolTYSND1
SynonymsNET41
Descriptiontrypsin domain containing 1
ReferenceMIM:611017|HGNC:HGNC:28531|Ensembl:ENSG00000156521|HPRD:15593|Vega:OTTHUMG00000018397
Gene typeprotein-coding
Map location10q22.1
Pascal p-value0.273
Sherlock p-value0.261
Fetal beta0.669
DMG1 (# studies)

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Jaffe_2016Genome-wide DNA methylation analysisThis dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. 1
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg188150061071906516TYSND12.14E-9-0.011.69E-6DMG:Jaffe_2016


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004252serine-type endopeptidase activityIEAglutamate (GO term level: 7)-
GO:0008233peptidase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006508proteolysisIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005777peroxisomeIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER UP 206111All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS UP 473314All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS 1174695All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER 747453All SZGR 2.0 genes in this pathway
MORI EMU MYC LYMPHOMA BY ONSET TIME UP 11069All SZGR 2.0 genes in this pathway
KEEN RESPONSE TO ROSIGLITAZONE UP 3823All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 5 12678All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566371All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP 221150All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2 182102All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE DN 841431All SZGR 2.0 genes in this pathway
LU EZH2 TARGETS UP 295155All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D 882506All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124/506619625m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC