Gene Page: SEPHS2
Summary ?
| GeneID | 22928 |
| Symbol | SEPHS2 |
| Synonyms | SPS2|SPS2b |
| Description | selenophosphate synthetase 2 |
| Reference | MIM:606218|HGNC:HGNC:19686|HPRD:12096| |
| Gene type | protein-coding |
| Map location | 16p11.2 |
| Pascal p-value | 0.033 |
| Sherlock p-value | 0.468 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01775 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs11199526 | chr10 | 122510388 | SEPHS2 | 22928 | 0.06 | trans | ||
| rs11199540 | chr10 | 122530843 | SEPHS2 | 22928 | 0.02 | trans | ||
| rs731616 | chr11 | 70627158 | SEPHS2 | 22928 | 0.05 | trans | ||
| rs10144869 | chr14 | 55726091 | SEPHS2 | 22928 | 0.18 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| WDR47 | 0.94 | 0.96 |
| ANKMY2 | 0.93 | 0.94 |
| RUFY3 | 0.92 | 0.95 |
| AZIN1 | 0.92 | 0.94 |
| FYTTD1 | 0.92 | 0.95 |
| BNIP3L | 0.92 | 0.95 |
| ACTR3 | 0.92 | 0.93 |
| VTA1 | 0.92 | 0.94 |
| ATF2 | 0.91 | 0.93 |
| KIFAP3 | 0.91 | 0.92 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MT-CO2 | -0.77 | -0.84 |
| FXYD1 | -0.77 | -0.86 |
| AF347015.31 | -0.76 | -0.84 |
| AF347015.33 | -0.75 | -0.81 |
| HSD17B14 | -0.75 | -0.80 |
| HIGD1B | -0.75 | -0.84 |
| TSC22D4 | -0.74 | -0.81 |
| IFI27 | -0.74 | -0.84 |
| MT-CYB | -0.74 | -0.81 |
| AIFM3 | -0.74 | -0.78 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0003824 | catalytic activity | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0004756 | selenide, water dikinase activity | IEA | - | |
| GO:0004756 | selenide, water dikinase activity | NAS | 8986768 | |
| GO:0008430 | selenium binding | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016260 | selenocysteine biosynthetic process | NAS | 8986768 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005575 | cellular_component | ND | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG SELENOAMINO ACID METABOLISM | 26 | 18 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID UP | 25 | 18 | All SZGR 2.0 genes in this pathway |
| FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
| PUIFFE INVASION INHIBITED BY ASCITES DN | 145 | 91 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 1 UP | 380 | 236 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN MLL SIGNATURE 2 UP | 418 | 263 | All SZGR 2.0 genes in this pathway |
| CHIARADONNA NEOPLASTIC TRANSFORMATION KRAS UP | 126 | 72 | All SZGR 2.0 genes in this pathway |
| CHIARADONNA NEOPLASTIC TRANSFORMATION CDC25 UP | 120 | 73 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN UP | 1142 | 669 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP | 612 | 367 | All SZGR 2.0 genes in this pathway |
| BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
| OUELLET CULTURED OVARIAN CANCER INVASIVE VS LMP UP | 69 | 40 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER APOCRINE VS LUMINAL | 326 | 213 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER APOCRINE VS BASAL | 330 | 217 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
| GROSS HYPOXIA VIA ELK3 AND HIF1A DN | 103 | 71 | All SZGR 2.0 genes in this pathway |
| NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
| RICKMAN METASTASIS UP | 344 | 180 | All SZGR 2.0 genes in this pathway |
| GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN | 206 | 136 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| KENNY CTNNB1 TARGETS UP | 50 | 30 | All SZGR 2.0 genes in this pathway |
| BECKER TAMOXIFEN RESISTANCE UP | 50 | 36 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| HSIAO LIVER SPECIFIC GENES | 244 | 154 | All SZGR 2.0 genes in this pathway |
| LI WILMS TUMOR VS FETAL KIDNEY 1 UP | 182 | 119 | All SZGR 2.0 genes in this pathway |
| WANG CISPLATIN RESPONSE AND XPC DN | 228 | 146 | All SZGR 2.0 genes in this pathway |
| YAMAZAKI TCEB3 TARGETS DN | 215 | 132 | All SZGR 2.0 genes in this pathway |
| WELCSH BRCA1 TARGETS UP | 198 | 132 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
| ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
| BOCHKIS FOXA2 TARGETS | 425 | 261 | All SZGR 2.0 genes in this pathway |
| LIN NPAS4 TARGETS UP | 163 | 100 | All SZGR 2.0 genes in this pathway |
| CUI GLUCOSE DEPRIVATION | 60 | 44 | All SZGR 2.0 genes in this pathway |
| BLUM RESPONSE TO SALIRASIB UP | 245 | 159 | All SZGR 2.0 genes in this pathway |
| ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
| DANG REGULATED BY MYC UP | 72 | 53 | All SZGR 2.0 genes in this pathway |
| WONG EMBRYONIC STEM CELL CORE | 335 | 193 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-133 | 403 | 409 | 1A | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
| hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
| miR-150 | 610 | 616 | 1A | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
| miR-339 | 325 | 331 | 1A | hsa-miR-339 | UCCCUGUCCUCCAGGAGCUCA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.