|
|
| GeneID |
23381
|
| Symbol |
SMG5
|
| Synonyms |
EST1B|FLJ34864|KIAA1089|LPTS-RP1|LPTSRP1|RP11-54H19.7|SMG-5
|
| Description |
Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) |
| See related |
HGNC:24644|MIM:610962|Ensembl:ENSG00000198952|HPRD:16869| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
1q21.2 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GSMA_I | genome scan meta-analysis | Psr: 0.0235 | | | GSMA_IIA | genome scan meta-analysis (All samples) | Psr: 0.00814 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
| NID2 | 0.81 | 0.52 | | |
| SLC26A2 | 0.76 | 0.52 | | |
| COL3A1 | 0.76 | 0.34 | | |
| NID1 | 0.76 | 0.45 | | |
| COL6A3 | 0.76 | 0.19 | | |
| CD93 | 0.74 | 0.46 | | |
| FBN2 | 0.74 | 0.55 | | |
| COL4A1 | 0.73 | 0.46 | | |
| COL1A2 | 0.73 | 0.29 | | |
| SLC6A4 | 0.72 | 0.34 | | |
Top 10 negatively co-expressed genes | | C5orf53 | -0.37 | -0.47 | | |
| AF347015.31 | -0.35 | -0.51 | | |
| MT-CO2 | -0.35 | -0.52 | | |
| AF347015.27 | -0.34 | -0.50 | | |
| AF347015.33 | -0.34 | -0.49 | | |
| ASPHD1 | -0.34 | -0.34 | | |
| MT-CYB | -0.34 | -0.49 | | |
| HLA-F | -0.34 | -0.38 | | |
| AF347015.8 | -0.34 | -0.50 | | |
| CXCL14 | -0.33 | -0.49 | | |
|
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005515 | protein binding | IPI | | 12699629 |14636577 |
| GO:0051721 | protein phosphatase 2A binding | IDA | | 14636577 |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0000184 | nuclear-transcribed mRNA catabolic process, nonsense-mediated decay | TAS | | 16488880 |
| GO:0006406 | mRNA export from nucleus | TAS | | 16488880 |
| GO:0035303 | regulation of dephosphorylation | IMP | | 14636577 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005634 | nucleus | IDA | | 14636577 |
| GO:0005737 | cytoplasm | IDA | | 14636577 |
| |
|
|
| |
|
|
|
| miR-433-3p | 1039 | 1046 | 1A,m8 | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|
