Gene Page: SMG5
Summary ?
GeneID | 23381 |
Symbol | SMG5 |
Synonyms | EST1B|LPTS-RP1|LPTSRP1|SMG-5 |
Description | SMG5 nonsense mediated mRNA decay factor |
Reference | MIM:610962|HGNC:HGNC:24644|Ensembl:ENSG00000198952|HPRD:16869|Vega:OTTHUMG00000017491 |
Gene type | protein-coding |
Map location | 1q21.2 |
Sherlock p-value | 0.031 |
Fetal beta | -0.375 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
NID2 | 0.81 | 0.52 |
SLC26A2 | 0.76 | 0.52 |
COL3A1 | 0.76 | 0.34 |
NID1 | 0.76 | 0.45 |
COL6A3 | 0.76 | 0.19 |
CD93 | 0.74 | 0.46 |
FBN2 | 0.74 | 0.55 |
COL4A1 | 0.73 | 0.46 |
COL1A2 | 0.73 | 0.29 |
SLC6A4 | 0.72 | 0.34 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
C5orf53 | -0.37 | -0.47 |
AF347015.31 | -0.35 | -0.51 |
MT-CO2 | -0.35 | -0.52 |
AF347015.27 | -0.34 | -0.50 |
AF347015.33 | -0.34 | -0.49 |
ASPHD1 | -0.34 | -0.34 |
MT-CYB | -0.34 | -0.49 |
HLA-F | -0.34 | -0.38 |
AF347015.8 | -0.34 | -0.50 |
CXCL14 | -0.33 | -0.49 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 12699629 |14636577 | |
GO:0051721 | protein phosphatase 2A binding | IDA | 14636577 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000184 | nuclear-transcribed mRNA catabolic process, nonsense-mediated decay | TAS | 16488880 | |
GO:0006406 | mRNA export from nucleus | TAS | 16488880 | |
GO:0035303 | regulation of dephosphorylation | IMP | 14636577 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IDA | 14636577 | |
GO:0005737 | cytoplasm | IDA | 14636577 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID HDAC CLASSI PATHWAY | 66 | 50 | All SZGR 2.0 genes in this pathway |
PID TELOMERASE PATHWAY | 68 | 48 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF MRNA | 284 | 128 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF RNA | 330 | 155 | All SZGR 2.0 genes in this pathway |
REACTOME NONSENSE MEDIATED DECAY ENHANCED BY THE EXON JUNCTION COMPLEX | 176 | 57 | All SZGR 2.0 genes in this pathway |
BASAKI YBX1 TARGETS UP | 290 | 177 | All SZGR 2.0 genes in this pathway |
GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
LIAO HAVE SOX4 BINDING SITES | 40 | 26 | All SZGR 2.0 genes in this pathway |
LIAO METASTASIS | 539 | 324 | All SZGR 2.0 genes in this pathway |
BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
BENPORATH OCT4 TARGETS | 290 | 172 | All SZGR 2.0 genes in this pathway |
FAELT B CLL WITH VH3 21 UP | 44 | 30 | All SZGR 2.0 genes in this pathway |
HU GENOTOXIC DAMAGE 4HR | 35 | 28 | All SZGR 2.0 genes in this pathway |
MONNIER POSTRADIATION TUMOR ESCAPE UP | 393 | 244 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN | 354 | 216 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 7 | 76 | 46 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-433-3p | 1039 | 1046 | 1A,m8 | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.