Gene Page: MAPK8IP2
Summary ?
| GeneID | 23542 |
| Symbol | MAPK8IP2 |
| Synonyms | IB-2|IB2|JIP2|PRKM8IPL |
| Description | mitogen-activated protein kinase 8 interacting protein 2 |
| Reference | MIM:607755|HGNC:HGNC:6883|Ensembl:ENSG00000008735|HPRD:09674|Vega:OTTHUMG00000150181 |
| Gene type | protein-coding |
| Map location | 22q13.33 |
| Pascal p-value | 0.02 |
| Sherlock p-value | 0.979 |
| eGene | Hippocampus |
| Support | INTRACELLULAR SIGNAL TRANSDUCTION |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0001540 | beta-amyloid binding | NAS | 12023290 | |
| GO:0005078 | MAP-kinase scaffold activity | NAS | 10490659 | |
| GO:0005198 | structural molecule activity | TAS | 10490659 | |
| GO:0019894 | kinesin binding | ISS | - | |
| GO:0019901 | protein kinase binding | IPI | 10490659 | |
| GO:0030295 | protein kinase activator activity | IDA | 12244047 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007172 | signal complex assembly | TAS | 10490659 | |
| GO:0045768 | positive regulation of anti-apoptosis | NAS | 10756100 | |
| GO:0046328 | regulation of JNK cascade | IDA | 10490659 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0043025 | cell soma | IEA | axon, dendrite (GO term level: 4) | - |
| GO:0005737 | cytoplasm | IDA | 10490659 |
Section IV. Protein-protein interaction annotation
| Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
|---|---|---|---|---|---|
| DUSP16 | KIAA1700 | MGC129701 | MGC129702 | MKP-7 | MKP7 | dual specificity phosphatase 16 | - | HPRD,BioGRID | 12524447 |
| FGF12 | FGF12B | FHF1 | fibroblast growth factor 12 | - | HPRD,BioGRID | 11378392 |
| FGF13 | FGF2 | FHF2 | fibroblast growth factor 13 | - | HPRD,BioGRID | 12244047 |
| IL1B | IL-1 | IL1-BETA | IL1F2 | interleukin 1, beta | Phenotypic Suppression | BioGRID | 10756100 |
| LRP1 | A2MR | APOER | APR | CD91 | FLJ16451 | IGFBP3R | LRP | MGC88725 | TGFBR5 | low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) | Reconstituted Complex Two-hybrid | BioGRID | 10827173 |
| LRP2 | DBS | gp330 | low density lipoprotein-related protein 2 | Reconstituted Complex Two-hybrid | BioGRID | 10827173 |12508107 |
| LRP8 | APOER2 | HSZ75190 | MCI1 | low density lipoprotein receptor-related protein 8, apolipoprotein e receptor | Two-hybrid | BioGRID | 10827173 |
| MAP2K3 | MAPKK3 | MEK3 | MKK3 | PRKMK3 | mitogen-activated protein kinase kinase 3 | Affinity Capture-Western | BioGRID | 12024021 |
| MAP2K7 | Jnkk2 | MAPKK7 | MKK7 | PRKMK7 | mitogen-activated protein kinase kinase 7 | - | HPRD,BioGRID | 10756100 |
| MAP3K10 | MLK2 | MST | mitogen-activated protein kinase kinase kinase 10 | Affinity Capture-Western Reconstituted Complex | BioGRID | 10490659 |
| MAP3K11 | MGC17114 | MLK-3 | MLK3 | PTK1 | SPRK | mitogen-activated protein kinase kinase kinase 11 | - | HPRD,BioGRID | 10490659 |
| MAP3K12 | DLK | MUK | ZPK | ZPKP1 | mitogen-activated protein kinase kinase kinase 12 | Affinity Capture-Western Reconstituted Complex | BioGRID | 10490659 |
| MAPK10 | FLJ12099 | FLJ33785 | JNK3 | JNK3A | MGC50974 | PRKM10 | p493F12 | p54bSAPK | mitogen-activated protein kinase 10 | Reconstituted Complex | BioGRID | 10756100 |
| MAPK13 | MGC99536 | PRKM13 | SAPK4 | p38delta | mitogen-activated protein kinase 13 | - | HPRD,BioGRID | 12244047 |
| MAPK8 | JNK | JNK1 | JNK1A2 | JNK21B1/2 | PRKM8 | SAPK1 | mitogen-activated protein kinase 8 | - | HPRD | 10756100 |
| MAPK8IP1 | IB1 | JIP-1 | JIP1 | PRKM8IP | mitogen-activated protein kinase 8 interacting protein 1 | Affinity Capture-Western Reconstituted Complex | BioGRID | 10490659 |
| MAPK8IP2 | IB2 | JIP2 | PRKM8IPL | mitogen-activated protein kinase 8 interacting protein 2 | Affinity Capture-Western | BioGRID | 10490659 |
| MAPK8IP3 | DKFZp762N1113 | FLJ00027 | JIP3 | JSAP1 | KIAA1066 | SYD2 | mitogen-activated protein kinase 8 interacting protein 3 | - | HPRD,BioGRID | 10629060 |
| MAPK9 | JNK-55 | JNK2 | JNK2A | JNK2ALPHA | JNK2B | JNK2BETA | PRKM9 | SAPK | p54a | p54aSAPK | mitogen-activated protein kinase 9 | Affinity Capture-Western Reconstituted Complex | BioGRID | 10490659 |
| PRSS23 | MGC5107 | SIG13 | SPUVE | ZSIG13 | protease, serine, 23 | Two-hybrid | BioGRID | 16169070 |
| TIAM1 | FLJ36302 | T-cell lymphoma invasion and metastasis 1 | Affinity Capture-Western | BioGRID | 12024021 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG MAPK SIGNALING PATHWAY | 267 | 205 | All SZGR 2.0 genes in this pathway |
| ST DIFFERENTIATION PATHWAY IN PC12 CELLS | 45 | 35 | All SZGR 2.0 genes in this pathway |
| SIG CD40PATHWAYMAP | 34 | 28 | All SZGR 2.0 genes in this pathway |
| ST GRANULE CELL SURVIVAL PATHWAY | 27 | 23 | All SZGR 2.0 genes in this pathway |
| ST INTEGRIN SIGNALING PATHWAY | 82 | 62 | All SZGR 2.0 genes in this pathway |
| ST FAS SIGNALING PATHWAY | 65 | 54 | All SZGR 2.0 genes in this pathway |
| HAMAI APOPTOSIS VIA TRAIL DN | 186 | 107 | All SZGR 2.0 genes in this pathway |
| AIYAR COBRA1 TARGETS UP | 39 | 25 | All SZGR 2.0 genes in this pathway |
| PATIL LIVER CANCER | 747 | 453 | All SZGR 2.0 genes in this pathway |
| GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| MOREAUX MULTIPLE MYELOMA BY TACI UP | 412 | 249 | All SZGR 2.0 genes in this pathway |
| MOREAUX B LYMPHOCYTE MATURATION BY TACI UP | 92 | 58 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 14HR UP | 156 | 101 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-188 | 461 | 467 | m8 | hsa-miR-188 | CAUCCCUUGCAUGGUGGAGGGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.