SZGR2

Summary ?

GeneID	2700
Symbol	GJA3
Synonyms	CTRCT14\|CX46\|CZP3
Description	gap junction protein alpha 3
Reference	MIM:121015\|HGNC:HGNC:4277\|Ensembl:ENSG00000121743\|HPRD:00415\|Vega:OTTHUMG00000016510
Gene type	protein-coding
Map location	13q12.11
Pascal p-value	0.724
Fetal beta	0.028
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg19436414	13	20734680	GJA3	2.69E-9	-0.019	1.95E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007267	cell-cell signaling	TAS		9413992
GO:0007601	visual perception	TAS		10205266
GO:0006810	transport	NAS		9413992
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016021	integral to membrane	IEA		-
GO:0005922	connexon complex	IEA		-
GO:0005886	plasma membrane	IEA		-
GO:0030054	cell junction	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
REACTOME MEMBRANE TRAFFICKING	129	74	All SZGR 2.0 genes in this pathway
REACTOME GAP JUNCTION TRAFFICKING	27	19	All SZGR 2.0 genes in this pathway
REACTOME GAP JUNCTION ASSEMBLY	18	12	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION DN	329	219	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX UP	83	66	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP	491	316	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12	317	177	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K27ME3	269	159	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3	349	234	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3	210	148	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 10HR UP	199	143	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-182	494	501	1A,m8	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-185	388	394	1A	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-96	495	501	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: GJA3