Gene Page: GLRB
Summary ?
GeneID | 2743 |
Symbol | GLRB |
Synonyms | HKPX2 |
Description | glycine receptor beta |
Reference | MIM:138492|HGNC:HGNC:4329|Ensembl:ENSG00000109738|HPRD:11751|Vega:OTTHUMG00000161954 |
Gene type | protein-coding |
Map location | 4q31.3 |
Pascal p-value | 0.328 |
Sherlock p-value | 0.959 |
Fetal beta | -1.865 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 5 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg10120856 | 4 | 157996959 | GLRB | 2.863E-4 | 0.382 | 0.039 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
TPP1 | 0.90 | 0.93 |
C5orf4 | 0.88 | 0.87 |
CDH20 | 0.87 | 0.86 |
IGSF11 | 0.86 | 0.86 |
GALNTL2 | 0.86 | 0.82 |
GPRC5B | 0.85 | 0.83 |
PADI2 | 0.85 | 0.84 |
WIPF1 | 0.85 | 0.90 |
KCNJ10 | 0.85 | 0.90 |
ATP10B | 0.85 | 0.83 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
NR2C2AP | -0.57 | -0.59 |
AIM2 | -0.56 | -0.62 |
KIAA1949 | -0.54 | -0.45 |
STMN1 | -0.53 | -0.51 |
MED19 | -0.53 | -0.56 |
ZNF300 | -0.53 | -0.43 |
TUBB2B | -0.53 | -0.50 |
RBMX2 | -0.53 | -0.61 |
CCDC28B | -0.53 | -0.60 |
ZNF821 | -0.52 | -0.45 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0030594 | neurotransmitter receptor activity | IEA | Neurotransmitter (GO term level: 5) | - |
GO:0005515 | protein binding | IPI | 11929858 |15215304 | |
GO:0005216 | ion channel activity | IEA | - | |
GO:0005230 | extracellular ligand-gated ion channel activity | IEA | - | |
GO:0016934 | extracellular-glycine-gated chloride channel activity | IDA | 8717357 | |
GO:0016594 | glycine binding | IMP | 15748848 | |
GO:0031404 | chloride ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007268 | synaptic transmission | IMP | neuron, Synap, Neurotransmitter (GO term level: 6) | 11929858 |
GO:0007218 | neuropeptide signaling pathway | IDA | Neurotransmitter (GO term level: 8) | 8717357 |
GO:0007399 | nervous system development | IMP | neurite (GO term level: 5) | 11929858 |
GO:0001964 | startle response | IMP | 11929858 | |
GO:0006821 | chloride transport | IEA | - | |
GO:0006811 | ion transport | IDA | 8717357 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0045211 | postsynaptic membrane | IEA | Synap, Neurotransmitter (GO term level: 5) | - |
GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0005886 | plasma membrane | IEA | - | |
GO:0005887 | integral to plasma membrane | NAS | 8717357 | |
GO:0030054 | cell junction | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES | 413 | 270 | All SZGR 2.0 genes in this pathway |
REACTOME ION CHANNEL TRANSPORT | 55 | 42 | All SZGR 2.0 genes in this pathway |
REACTOME LIGAND GATED ION CHANNEL TRANSPORT | 21 | 21 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 UP | 256 | 159 | All SZGR 2.0 genes in this pathway |
FRASOR RESPONSE TO ESTRADIOL UP | 37 | 28 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 UP | 428 | 266 | All SZGR 2.0 genes in this pathway |
TSENG IRS1 TARGETS UP | 113 | 71 | All SZGR 2.0 genes in this pathway |
TSENG ADIPOGENIC POTENTIAL UP | 30 | 19 | All SZGR 2.0 genes in this pathway |
BILD E2F3 ONCOGENIC SIGNATURE | 246 | 153 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER WITH H3K27ME3 UP | 295 | 149 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER RELAPSE IN LIVER DN | 10 | 9 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER LUMINAL B UP | 172 | 109 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
ZHANG BREAST CANCER PROGENITORS UP | 425 | 253 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 0 | 76 | 54 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP | 682 | 440 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS CALB1 CORR UP | 548 | 370 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 797 | 804 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-135 | 404 | 410 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-18 | 139 | 146 | 1A,m8 | hsa-miR-18a | UAAGGUGCAUCUAGUGCAGAUA |
hsa-miR-18b | UAAGGUGCAUCUAGUGCAGUUA | ||||
miR-203.1 | 33 | 39 | 1A | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-369-3p | 435 | 441 | m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.