SZGR2

Summary ?

GeneID	4081
Symbol	MAB21L1
Synonyms	CAGR1\|Nbla00126
Description	mab-21-like 1 (C. elegans)
Reference	MIM:601280\|HGNC:HGNC:6757\|HPRD:03178\|
Gene type	protein-coding
Map location	13q13
Fetal beta	0.848
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs16829545	chr2	151977407	MAB21L1	4081	2.435E-21	trans
rs3845734	chr2	171125572	MAB21L1	4081	0.07	trans
rs7584986	chr2	184111432	MAB21L1	4081	8.99E-11	trans
rs6741060	chr2	217169088	MAB21L1	4081	0.15	trans
rs9810143	chr3	5060209	MAB21L1	4081	0.12	trans
rs2183142	chr4	159232695	MAB21L1	4081	6.661E-4	trans
rs170776	chr4	173276735	MAB21L1	4081	0.01	trans
rs1396222	chr4	173279496	MAB21L1	4081	0	trans
rs335993	chr4	173321789	MAB21L1	4081	0	trans
rs335980	chr4	173329784	MAB21L1	4081	0.01	trans
rs335982	chr4	173330945	MAB21L1	4081	0.06	trans
rs337984	chr4	173411662	MAB21L1	4081	0.04	trans
rs10491487	chr5	80323367	MAB21L1	4081	5.758E-5	trans
rs13191953	chr6	24151042	MAB21L1	4081	0.15	trans
rs12196880	chr6	24313746	MAB21L1	4081	0.17	trans
rs10806988	chr6	24341768	MAB21L1	4081	0.11	trans
rs9461864	chr6	33481468	MAB21L1	4081	0.03	trans
rs16890367	chr6	38078448	MAB21L1	4081	0.03	trans
rs1869293	chr7	158181108	MAB21L1	4081	0.18	trans
rs9638062	chr7	158221572	MAB21L1	4081	0.18	trans
rs6996695	chr8	77540580	MAB21L1	4081	0	trans
rs3118341	chr9	25185518	MAB21L1	4081	0.06	trans
rs1126130	chr9	25209346	MAB21L1	4081	0.15	trans
rs1998746	chr9	25211761	MAB21L1	4081	0.15	trans
rs1332433	chr9	25214440	MAB21L1	4081	0.2	trans
rs9406868	chr9	25223372	MAB21L1	4081	9.325E-4	trans
rs11139334	chr9	84209393	MAB21L1	4081	3.186E-4	trans
rs4837782	chr9	123330812	MAB21L1	4081	0.15	trans
rs17143839	chr10	8520836	MAB21L1	4081	0.12	trans
rs12098525	chr10	87501764	MAB21L1	4081	0.17	trans
rs4122086	chr11	92430845	MAB21L1	4081	0.11	trans
rs10501795	chr11	92447417	MAB21L1	4081	0.11	trans
rs10501796	chr11	92453155	MAB21L1	4081	0.11	trans
rs9989228	chr14	37809252	MAB21L1	4081	0.09	trans
rs16955618	chr15	29937543	MAB21L1	4081	1.143E-23	trans
rs2077735	chr15	58479024	MAB21L1	4081	0.04	trans
rs9941296	chr16	2759498	MAB21L1	4081	0.01	trans
rs16945437	chr17	11797650	MAB21L1	4081	0.04	trans
rs11873184	chr18	1584081	MAB21L1	4081	0.13	trans
rs11882889	chr19	19887684	MAB21L1	4081	0.11	trans
rs1041786	chr21	22617710	MAB21L1	4081	0.01	trans
rs16981387	chr22	26495864	MAB21L1	4081	0.15	trans
rs16986332	chrX	10958354	MAB21L1	4081	0.03	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008284	positive regulation of cell proliferation	IEA		-
GO:0009653	anatomical structure morphogenesis	TAS		8733127
GO:0007275	multicellular organismal development	IEA		-
GO:0043010	camera-type eye development	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 8HR DN	129	84	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN DN	172	112	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
RORIE TARGETS OF EWSR1 FLI1 FUSION DN	30	23	All SZGR 2.0 genes in this pathway
REN ALVEOLAR RHABDOMYOSARCOMA UP	98	64	All SZGR 2.0 genes in this pathway
TRAYNOR RETT SYNDROM DN	19	14	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS DN	120	81	All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN	940	425	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3 UNMETHYLATED	536	296	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 2HR DN	49	33	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA CLASSICAL	162	122	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM A	182	108	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	655	662	1A,m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-143	144	151	1A,m8	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-199	770	777	1A,m8	hsa-miR-199a	CCCAGUGUUCAGACUACCUGUUC
miR-199	770	777	1A,m8	hsa-miR-199b	CCCAGUGUUUAGACUAUCUGUUC
miR-26	669	676	1A,m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
				hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
				hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
				hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-30-5p	616	622	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-363	93	99	1A	hsa-miR-363	AUUGCACGGUAUCCAUCUGUAA
miR-409-3p	654	660	m8	hsa-miR-409-3p	CGAAUGUUGCUCGGUGAACCCCU
miR-410	742	748	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-410	742	748	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-452	94	101	1A,m8	hsa-miR-452	UGUUUGCAGAGGAAACUGAGAC
miR-543	676	682	1A	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MAB21L1