SZGR2

Summary ?

GeneID	4761
Symbol	NEUROD2
Synonyms	NDRF\|bHLHa1
Description	neuronal differentiation 2
Reference	MIM:601725\|HGNC:HGNC:7763\|HPRD:03429\|
Gene type	protein-coding
Map location	17q12
Pascal p-value	3.437E-4
Sherlock p-value	0.043
Fetal beta	2.13
DMG	1 (# studies)
eGene	Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg01293647	17	37764264	NEUROD2		-0.027	0.31	DMG:Nishioka_2013

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
HYAL2	0.68	0.71
CDC42EP4	0.63	0.66
SLC39A1	0.63	0.64
MKNK2	0.63	0.60
CORO1B	0.62	0.63
SEMA4B	0.61	0.65
XKR8	0.60	0.62
MAFF	0.60	0.62
RBM38	0.60	0.60
FADS2	0.60	0.62

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AC104794.1	-0.52	-0.49
RERGL	-0.51	-0.50
SYCP3	-0.50	-0.42
USMG5	-0.48	-0.52
C5orf53	-0.47	-0.46
PIGB	-0.47	-0.49
SATL1	-0.44	-0.43
UROS	-0.44	-0.41
MAEL	-0.44	-0.46
LY96	-0.43	-0.44

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	TAS		8816493
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0048666	neuron development	IEA	neuron (GO term level: 9)	-
GO:0007399	nervous system development	TAS	neurite (GO term level: 5)	8816493
GO:0001662	behavioral fear response	IEA		-
GO:0006357	regulation of transcription from RNA polymerase II promoter	TAS		8816493
GO:0008306	associative learning	IEA		-
GO:0007275	multicellular organismal development	IEA		-
GO:0030154	cell differentiation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 17Q11 Q21 AMPLICON	133	78	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS UP	100	72	All SZGR 2.0 genes in this pathway
CADWELL ATG16L1 TARGETS UP	93	56	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3	349	234	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3	341	243	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-129-5p	1509	1515	m8	hsa-miR-129^brain	CUUUUUGCGGUCUGGGCUUGC
miR-129-5p	1509	1515	m8	hsa-miR-129-5p	CUUUUUGCGGUCUGGGCUUGCU
miR-137	762	769	1A,m8	hsa-miR-137	UAUUGCUUAAGAAUACGCGUAG
miR-153	845	852	1A,m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-17-5p/20/93.mr/106/519.d	939	945	m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-185	208	214	m8	hsa-miR-185^brain	UGGAGAGAAAGGCAGUUC
miR-210	1171	1178	1A,m8	hsa-miR-210	CUGUGCGUGUGACAGCGGCUGA
miR-219	992	998	1A	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-331	173	179	m8	hsa-miR-331^brain	GCCCCUGGGCCUAUCCUAGAA
miR-34/449	1027	1033	m8	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC
miR-448	846	852	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-450	1509	1515	1A	hsa-miR-450	UUUUUGCGAUGUGUUCCUAAUA
miR-496	1660	1666	1A	hsa-miR-496	AUUACAUGGCCAAUCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NEUROD2