Gene Page: NOTCH2
Summary ?
| GeneID | 4853 |
| Symbol | NOTCH2 |
| Synonyms | AGS2|HJCYS|hN2 |
| Description | notch 2 |
| Reference | MIM:600275|HGNC:HGNC:7882|Ensembl:ENSG00000134250|HPRD:02606|Vega:OTTHUMG00000012177 |
| Gene type | protein-coding |
| Map location | 1p13-p11 |
| Pascal p-value | 0.798 |
| Fetal beta | 0.944 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
| Expression | Meta-analysis of gene expression | P value: 1.399 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs9876344 | chr3 | 77305890 | NOTCH2 | 4853 | 0.2 | trans | ||
| rs10842689 | chr12 | 26338364 | NOTCH2 | 4853 | 0.2 | trans | ||
| rs695809 | chr22 | 26278127 | NOTCH2 | 4853 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MFSD4 | 0.92 | 0.78 |
| CREG2 | 0.91 | 0.69 |
| CAMKK1 | 0.90 | 0.89 |
| MAST3 | 0.90 | 0.82 |
| SV2B | 0.90 | 0.81 |
| IQSEC1 | 0.89 | 0.84 |
| SYN1 | 0.89 | 0.84 |
| KIAA1217 | 0.88 | 0.91 |
| IQSEC2 | 0.88 | 0.89 |
| PI4KA | 0.88 | 0.81 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| BCL7C | -0.47 | -0.53 |
| GTF3C6 | -0.44 | -0.36 |
| C9orf46 | -0.44 | -0.39 |
| C21orf57 | -0.44 | -0.44 |
| FAM36A | -0.43 | -0.29 |
| HEBP2 | -0.41 | -0.50 |
| EXOSC8 | -0.40 | -0.25 |
| AC006276.2 | -0.40 | -0.32 |
| RPL23A | -0.39 | -0.38 |
| FADS2 | -0.39 | -0.25 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004872 | receptor activity | NAS | 9244302 | |
| GO:0003706 | ligand-regulated transcription factor activity | TAS | 9244302 | |
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0005515 | protein binding | NAS | 12531696 | |
| GO:0046982 | protein heterodimerization activity | NAS | 9244302 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007399 | nervous system development | NAS | neurite (GO term level: 5) | 12760378 |
| GO:0001709 | cell fate determination | TAS | 9244302 | |
| GO:0006355 | regulation of transcription, DNA-dependent | TAS | 9244302 | |
| GO:0006350 | transcription | IEA | - | |
| GO:0016049 | cell growth | IDA | 11306509 | |
| GO:0007219 | Notch signaling pathway | IEA | - | |
| GO:0006917 | induction of apoptosis | TAS | 12531696 | |
| GO:0009887 | organ morphogenesis | IEP | 12531696 | |
| GO:0007050 | cell cycle arrest | IDA | 11306509 | |
| GO:0019827 | stem cell maintenance | TAS | 11306509 | |
| GO:0008285 | negative regulation of cell proliferation | IDA | 11306509 | |
| GO:0006916 | anti-apoptosis | TAS | 12531696 | |
| GO:0007275 | multicellular organismal development | NAS | 9244302 | |
| GO:0030154 | cell differentiation | IEA | - | |
| GO:0050793 | regulation of developmental process | IEA | - | |
| GO:0030097 | hemopoiesis | TAS | 1303260 | |
| GO:0046579 | positive regulation of Ras protein signal transduction | IDA | 11306509 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IDA | 1303260 | |
| GO:0009986 | cell surface | IDA | 9244302 | |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0005887 | integral to plasma membrane | IDA | 9244302 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG DORSO VENTRAL AXIS FORMATION | 25 | 21 | All SZGR 2.0 genes in this pathway |
| KEGG NOTCH SIGNALING PATHWAY | 47 | 35 | All SZGR 2.0 genes in this pathway |
| PID NOTCH PATHWAY | 59 | 49 | All SZGR 2.0 genes in this pathway |
| REACTOME PRE NOTCH TRANSCRIPTION AND TRANSLATION | 29 | 17 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY NOTCH2 | 12 | 10 | All SZGR 2.0 genes in this pathway |
| REACTOME PRE NOTCH EXPRESSION AND PROCESSING | 44 | 24 | All SZGR 2.0 genes in this pathway |
| REACTOME PRE NOTCH PROCESSING IN GOLGI | 16 | 10 | All SZGR 2.0 genes in this pathway |
| REACTOME GENERIC TRANSCRIPTION PATHWAY | 352 | 181 | All SZGR 2.0 genes in this pathway |
| REACTOME NOTCH HLH TRANSCRIPTION PATHWAY | 13 | 8 | All SZGR 2.0 genes in this pathway |
| REACTOME RECEPTOR LIGAND BINDING INITIATES THE SECOND PROTEOLYTIC CLEAVAGE OF NOTCH RECEPTOR | 12 | 8 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY NOTCH | 103 | 64 | All SZGR 2.0 genes in this pathway |
| HOLLMANN APOPTOSIS VIA CD40 DN | 267 | 178 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
| FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
| THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
| RHEIN ALL GLUCOCORTICOID THERAPY UP | 78 | 41 | All SZGR 2.0 genes in this pathway |
| PROVENZANI METASTASIS DN | 136 | 94 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| SHEPARD BMYB MORPHOLINO DN | 200 | 112 | All SZGR 2.0 genes in this pathway |
| SHEPARD BMYB TARGETS | 74 | 41 | All SZGR 2.0 genes in this pathway |
| SHEPARD CRUSH AND BURN MUTANT DN | 185 | 111 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
| VERRECCHIA RESPONSE TO TGFB1 C1 | 19 | 15 | All SZGR 2.0 genes in this pathway |
| VERRECCHIA EARLY RESPONSE TO TGFB1 | 58 | 43 | All SZGR 2.0 genes in this pathway |
| VERRECCHIA DELAYED RESPONSE TO TGFB1 | 39 | 26 | All SZGR 2.0 genes in this pathway |
| MOREIRA RESPONSE TO TSA DN | 18 | 16 | All SZGR 2.0 genes in this pathway |
| VERRECCHIA RESPONSE TO TGFB1 C4 | 13 | 10 | All SZGR 2.0 genes in this pathway |
| LEIN CHOROID PLEXUS MARKERS | 103 | 61 | All SZGR 2.0 genes in this pathway |
| MITSIADES RESPONSE TO APLIDIN DN | 249 | 165 | All SZGR 2.0 genes in this pathway |
| BOQUEST STEM CELL UP | 260 | 174 | All SZGR 2.0 genes in this pathway |
| BREDEMEYER RAG SIGNALING NOT VIA ATM UP | 62 | 29 | All SZGR 2.0 genes in this pathway |
| VART KSHV INFECTION ANGIOGENIC MARKERS UP | 165 | 118 | All SZGR 2.0 genes in this pathway |
| VART KSHV INFECTION ANGIOGENIC MARKERS DN | 138 | 92 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO CSF2RB AND IL4 DN | 315 | 201 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF DN | 235 | 144 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
| BRUNEAU HEART GREAT VESSELS AND VALVULOGENESIS | 8 | 8 | All SZGR 2.0 genes in this pathway |
| WOO LIVER CANCER RECURRENCE UP | 105 | 75 | All SZGR 2.0 genes in this pathway |
| CHICAS RB1 TARGETS CONFLUENT | 567 | 365 | All SZGR 2.0 genes in this pathway |
| FUKUSHIMA TNFSF11 TARGETS | 16 | 14 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| DUAN PRDM5 TARGETS | 79 | 52 | All SZGR 2.0 genes in this pathway |
| FEVR CTNNB1 TARGETS DN | 553 | 343 | All SZGR 2.0 genes in this pathway |
| KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
| SERVITJA ISLET HNF1A TARGETS UP | 163 | 111 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-23 | 2415 | 2422 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
| hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
| miR-34/449 | 2466 | 2472 | m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
| hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
| hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
| hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
| miR-409-5p | 3100 | 3106 | 1A | hsa-miR-409-5p | AGGUUACCCGAGCAACUUUGCA |
| miR-485-3p | 3085 | 3091 | m8 | hsa-miR-485-3p | GUCAUACACGGCUCUCCUCUCU |
| miR-9 | 2907 | 2913 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.