SZGR2

Summary ?

GeneID	5015
Symbol	OTX2
Synonyms	CPHD6\|MCOPS5
Description	orthodenticle homeobox 2
Reference	MIM:600037\|HGNC:HGNC:8522\|HPRD:07190\|
Gene type	protein-coding
Map location	14q22.3
Pascal p-value	0.086
Fetal beta	-0.131
DMG	2 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	3
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	3
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 6

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg23316987	14	57272594	OTX2	3.69E-6	-0.484	0.009	DMG:Wockner_2014
cg24748769	14	57271015	OTX2	1.636E-4	-0.359	0.033	DMG:Wockner_2014
cg13411015	14	57274900	OTX2	1.66E-8	-0.023	6.1E-6	DMG:Jaffe_2016

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs17091014	chr14	56562713	OTX2	5015	0.05	cis
rs512189	chr1	182632586	OTX2	5015	0.12	trans
rs6666913	chr1	237092144	OTX2	5015	0	trans
rs16865199	chr2	6621910	OTX2	5015	0.13	trans
rs16865228	chr2	6629622	OTX2	5015	0.1	trans
rs16865230	chr2	6630187	OTX2	5015	0.1	trans
rs11691188	chr2	6631799	OTX2	5015	0.1	trans
rs13403353	chr2	144067716	OTX2	5015	0.18	trans
rs7609917	chr3	76094301	OTX2	5015	0.01	trans
rs2324466	chr3	76100753	OTX2	5015	8.178E-5	trans
rs17013713	chr3	76105150	OTX2	5015	4.865E-5	trans
rs17013722	chr3	76107656	OTX2	5015	8.178E-5	trans
rs17013724	chr3	76107684	OTX2	5015	8.178E-5	trans
rs179852	chr3	172328734	OTX2	5015	0.06	trans
rs16831155	chr3	173574763	OTX2	5015	0.11	trans
rs10015205	chr4	26144278	OTX2	5015	0.1	trans
rs11734196	chr4	102796071	OTX2	5015	0.03	trans
rs10212684	chr4	102822506	OTX2	5015	0.01	trans
rs11937178	chr4	148847598	OTX2	5015	0.04	trans
rs11934409	chr4	148848884	OTX2	5015	0.04	trans
rs9986296	chr5	3199318	OTX2	5015	7.317E-4	trans
rs17502163	chr5	120026331	OTX2	5015	0.09	trans
rs2895773	chr5	148114635	OTX2	5015	0.14	trans
rs10059267	chr5	168676624	OTX2	5015	0.13	trans
rs10078402	chr5	168678851	OTX2	5015	0.13	trans
rs7740062	chr6	27705597	OTX2	5015	0.13	trans
rs200470	chr6	27762186	OTX2	5015	0.05	trans
rs201005	chr6	27804159	OTX2	5015	0.1	trans
rs200955	chr6	27839311	OTX2	5015	0.13	trans
rs200959	chr6	27842046	OTX2	5015	0.13	trans
rs839777	chr6	27909656	OTX2	5015	0.11	trans
rs149898	chr6	27958071	OTX2	5015	0.11	trans
rs156742	chr6	27963191	OTX2	5015	0.11	trans
rs175955	chr6	28059733	OTX2	5015	0.11	trans
rs1225593	chr6	28150518	OTX2	5015	0.11	trans
rs195749	chr6	37253745	OTX2	5015	0.01	trans
rs16896683	chr6	43687846	OTX2	5015	0.15	trans
rs17073406	chr6	144447390	OTX2	5015	0.06	trans
rs992435	chr7	97050802	OTX2	5015	0.11	trans
rs1017329	chr8	40281396	OTX2	5015	0.13	trans
rs16920368	chr8	55392852	OTX2	5015	0.01	trans
rs16927318	chr8	62365911	OTX2	5015	0.07	trans
rs348150	chr8	73371619	OTX2	5015	0.1	trans
rs16938220	chr8	73377940	OTX2	5015	0.09	trans
rs4734607	chr8	102991441	OTX2	5015	0.07	trans
rs4545144	chr8	139689307	OTX2	5015	0.13	trans
rs4742740	chr9	101524552	OTX2	5015	0.15	trans
rs2069410	chr12	56364644	OTX2	5015	3.293E-6	trans
rs11105124	chr12	89375908	OTX2	5015	0.16	trans
rs9670212	chr13	29070572	OTX2	5015	0.05	trans
rs17834315	chr13	37991091	OTX2	5015	5.564E-4	trans
rs11841288	chr13	60215833	OTX2	5015	0.09	trans
rs16946913	chr15	63653889	OTX2	5015	0.09	trans
rs7174517	chr15	87256320	OTX2	5015	0.15	trans
rs17694187	chr15	91881259	OTX2	5015	0.13	trans
rs17142983	chr16	7294508	OTX2	5015	0	trans
rs8056710	chr16	7447629	OTX2	5015	0.13	trans
rs6499075	chr16	66387395	OTX2	5015	0.01	trans
rs17736134	chr18	70665805	OTX2	5015	0.06	trans
rs2469060	chr18	70673106	OTX2	5015	0.06	trans
rs2469009	chr18	70713334	OTX2	5015	0.09	trans
rs409642	chr20	54250273	OTX2	5015	0.02	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	NAS		-
GO:0005515	protein binding	IEA		-
GO:0008190	eukaryotic initiation factor 4E binding	TAS		15705863
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007417	central nervous system development	IEA	Brain (GO term level: 6)	-
GO:0007411	axon guidance	IDA	axon (GO term level: 13)	16267555
GO:0048663	neuron fate commitment	IEA	neuron (GO term level: 9)	-
GO:0030901	midbrain development	TAS	Brain (GO term level: 8)	15705863
GO:0030900	forebrain development	TAS	Brain (GO term level: 8)	15705863
GO:0001708	cell fate specification	IEA		-
GO:0009953	dorsal/ventral pattern formation	IEA		-
GO:0009952	anterior/posterior pattern formation	IEA		-
GO:0009887	organ morphogenesis	IEA		-
GO:0008589	regulation of smoothened signaling pathway	TAS		15705863
GO:0007275	multicellular organismal development	IEA		-
GO:0042472	inner ear morphogenesis	IEA		-
GO:0042706	eye photoreceptor cell fate commitment	IEA		-
GO:0040036	regulation of fibroblast growth factor receptor signaling pathway	TAS		15705863
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030426	growth cone	IDA	axon, dendrite (GO term level: 5)	16267555
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP	408	247	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
KORKOLA YOLK SAC TUMOR	62	33	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
SHEPARD CRUSH AND BURN MUTANT DN	185	111	All SZGR 2.0 genes in this pathway
LEIN CHOROID PLEXUS MARKERS	103	61	All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY UP	250	168	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
SASAI TARGETS OF CXCR6 AND PTCH1 UP	13	9	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
WONG EMBRYONIC STEM CELL CORE	335	193	All SZGR 2.0 genes in this pathway
PASINI SUZ12 TARGETS UP	112	65	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4	227	149	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	51	58	1A,m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-128	621	627	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	621	627	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-130/301	503	509	1A	hsa-miR-130a^brain	CAGUGCAAUGUUAAAAGGGCAU
				hsa-miR-301	CAGUGCAAUAGUAUUGUCAAAGC
				hsa-miR-130b^brain	CAGUGCAAUGAUGAAAGGGCAU
				hsa-miR-454-3p	UAGUGCAAUAUUGCUUAUAGGGUUU
miR-138	171	177	1A	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-142-5p	509	515	m8	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-148/152	450	456	1A	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-153	641	647	1A	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-219	558	565	1A,m8	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-27	621	627	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	621	627	m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-30-3p	452	459	1A,m8	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	452	459	1A,m8	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-374	697	703	1A	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-410	955	962	1A,m8	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-448	641	647	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-448	641	647	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: OTX2