SZGR2

Summary ?

GeneID	51761
Symbol	ATP8A2
Synonyms	ATP\|ATPIB\|CAMRQ4\|IB\|ML-1
Description	ATPase phospholipid transporting 8A2
Reference	MIM:605870\|HGNC:HGNC:13533\|Ensembl:ENSG00000132932\|HPRD:05795\|Vega:OTTHUMG00000016611
Gene type	protein-coding
Map location	13q12
Pascal p-value	0.146
Fetal beta	-1.274
eGene	Cerebellum Myers' cis & trans
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWAScat	Genome-wide Association Studies	This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs12997903	chr2	1952083	ATP8A2	51761	0.19	trans
rs6733654	chr2	1963270	ATP8A2	51761	0.04	trans
rs934955	chr2	193537127	ATP8A2	51761	0.16	trans
rs6772815	chr3	5164768	ATP8A2	51761	0.12	trans
rs17029291	chr3	32402138	ATP8A2	51761	0.17	trans
rs17465252	chr3	118537078	ATP8A2	51761	0.18	trans
rs17069894	chr4	181542718	ATP8A2	51761	0.05	trans
rs7868778	chr9	133811342	ATP8A2	51761	0.09	trans
rs4607971	chr10	19407890	ATP8A2	51761	0	trans
rs10145685	chr14	22794892	ATP8A2	51761	0.12	trans
rs17793827	chr14	22797560	ATP8A2	51761	0.05	trans
rs10136383	chr14	22801078	ATP8A2	51761	0.05	trans
rs624778	chr15	48073967	ATP8A2	51761	0.06	trans
rs532707	chr15	48074070	ATP8A2	51761	0.06	trans
rs553338	chr15	48076921	ATP8A2	51761	0.06	trans
rs596942	chr15	48082150	ATP8A2	51761	0.05	trans
rs1761450	chr19	54818034	ATP8A2	51761	0.14	trans
rs9637082	chr21	21213235	ATP8A2	51761	1.26E-4	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0000287	magnesium ion binding	IEA		-
GO:0004012	phospholipid-translocating ATPase activity	IEA		-
GO:0005524	ATP binding	IEA		-
GO:0016787	hydrolase activity	IEA		-
GO:0016820	hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances	IEA		-
GO:0015662	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008285	negative regulation of cell proliferation	TAS		10551800
GO:0006810	transport	IEA		-
GO:0015914	phospholipid transport	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016020	membrane	IEA		-
GO:0016021	integral to membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES	413	270	All SZGR 2.0 genes in this pathway
REACTOME ION TRANSPORT BY P TYPE ATPASES	34	21	All SZGR 2.0 genes in this pathway
REACTOME ION CHANNEL TRANSPORT	55	42	All SZGR 2.0 genes in this pathway
AKL HTLV1 INFECTION DN	68	41	All SZGR 2.0 genes in this pathway
WONG ENDMETRIUM CANCER DN	82	53	All SZGR 2.0 genes in this pathway
GALLUZZI PREVENT MITOCHONDIAL PERMEABILIZATION	22	16	All SZGR 2.0 genes in this pathway
HATADA METHYLATED IN LUNG CANCER UP	390	236	All SZGR 2.0 genes in this pathway
MANTOVANI NFKB TARGETS UP	43	33	All SZGR 2.0 genes in this pathway
MANTOVANI VIRAL GPCR SIGNALING UP	86	54	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP	487	286	All SZGR 2.0 genes in this pathway
URS ADIPOCYTE DIFFERENTIATION UP	74	51	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
LIU SMARCA4 TARGETS	64	39	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN	220	147	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K27ME3 DN	228	114	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
MIKKELSEN MCV6 HCP WITH H3K27ME3	435	318	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-150	331	337	1A	hsa-miR-150	UCUCCCAACCCUUGUACCAGUG
miR-203.1	111	117	m8	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-377	274	280	1A	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-495	40	46	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-495	40	46	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ATP8A2