Gene Page: ATP8A2
Summary ?
GeneID | 51761 |
Symbol | ATP8A2 |
Synonyms | ATP|ATPIB|CAMRQ4|IB|ML-1 |
Description | ATPase phospholipid transporting 8A2 |
Reference | MIM:605870|HGNC:HGNC:13533|Ensembl:ENSG00000132932|HPRD:05795|Vega:OTTHUMG00000016611 |
Gene type | protein-coding |
Map location | 13q12 |
Pascal p-value | 0.146 |
Fetal beta | -1.274 |
eGene | Cerebellum Myers' cis & trans |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWAScat | Genome-wide Association Studies | This data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb. | |
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs12997903 | chr2 | 1952083 | ATP8A2 | 51761 | 0.19 | trans | ||
rs6733654 | chr2 | 1963270 | ATP8A2 | 51761 | 0.04 | trans | ||
rs934955 | chr2 | 193537127 | ATP8A2 | 51761 | 0.16 | trans | ||
rs6772815 | chr3 | 5164768 | ATP8A2 | 51761 | 0.12 | trans | ||
rs17029291 | chr3 | 32402138 | ATP8A2 | 51761 | 0.17 | trans | ||
rs17465252 | chr3 | 118537078 | ATP8A2 | 51761 | 0.18 | trans | ||
rs17069894 | chr4 | 181542718 | ATP8A2 | 51761 | 0.05 | trans | ||
rs7868778 | chr9 | 133811342 | ATP8A2 | 51761 | 0.09 | trans | ||
rs4607971 | chr10 | 19407890 | ATP8A2 | 51761 | 0 | trans | ||
rs10145685 | chr14 | 22794892 | ATP8A2 | 51761 | 0.12 | trans | ||
rs17793827 | chr14 | 22797560 | ATP8A2 | 51761 | 0.05 | trans | ||
rs10136383 | chr14 | 22801078 | ATP8A2 | 51761 | 0.05 | trans | ||
rs624778 | chr15 | 48073967 | ATP8A2 | 51761 | 0.06 | trans | ||
rs532707 | chr15 | 48074070 | ATP8A2 | 51761 | 0.06 | trans | ||
rs553338 | chr15 | 48076921 | ATP8A2 | 51761 | 0.06 | trans | ||
rs596942 | chr15 | 48082150 | ATP8A2 | 51761 | 0.05 | trans | ||
rs1761450 | chr19 | 54818034 | ATP8A2 | 51761 | 0.14 | trans | ||
rs9637082 | chr21 | 21213235 | ATP8A2 | 51761 | 1.26E-4 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0000287 | magnesium ion binding | IEA | - | |
GO:0004012 | phospholipid-translocating ATPase activity | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
GO:0016787 | hydrolase activity | IEA | - | |
GO:0016820 | hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances | IEA | - | |
GO:0015662 | ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0008285 | negative regulation of cell proliferation | TAS | 10551800 | |
GO:0006810 | transport | IEA | - | |
GO:0015914 | phospholipid transport | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES | 413 | 270 | All SZGR 2.0 genes in this pathway |
REACTOME ION TRANSPORT BY P TYPE ATPASES | 34 | 21 | All SZGR 2.0 genes in this pathway |
REACTOME ION CHANNEL TRANSPORT | 55 | 42 | All SZGR 2.0 genes in this pathway |
AKL HTLV1 INFECTION DN | 68 | 41 | All SZGR 2.0 genes in this pathway |
WONG ENDMETRIUM CANCER DN | 82 | 53 | All SZGR 2.0 genes in this pathway |
GALLUZZI PREVENT MITOCHONDIAL PERMEABILIZATION | 22 | 16 | All SZGR 2.0 genes in this pathway |
HATADA METHYLATED IN LUNG CANCER UP | 390 | 236 | All SZGR 2.0 genes in this pathway |
MANTOVANI NFKB TARGETS UP | 43 | 33 | All SZGR 2.0 genes in this pathway |
MANTOVANI VIRAL GPCR SIGNALING UP | 86 | 54 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
URS ADIPOCYTE DIFFERENTIATION UP | 74 | 51 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
LIU SMARCA4 TARGETS | 64 | 39 | All SZGR 2.0 genes in this pathway |
ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
RIGGINS TAMOXIFEN RESISTANCE DN | 220 | 147 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER WITH H3K27ME3 DN | 228 | 114 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-150 | 331 | 337 | 1A | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
miR-203.1 | 111 | 117 | m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-377 | 274 | 280 | 1A | hsa-miR-377 | AUCACACAAAGGCAACUUUUGU |
miR-495 | 40 | 46 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.