Gene Page: POU6F1
Summary ?
| GeneID | 5463 |
| Symbol | POU6F1 |
| Synonyms | BRN5|MPOU|TCFB1 |
| Description | POU class 6 homeobox 1 |
| Reference | HGNC:HGNC:9224|Ensembl:ENSG00000184271|HPRD:17883|Vega:OTTHUMG00000169622 |
| Gene type | protein-coding |
| Map location | 12q13.13 |
| Pascal p-value | 0.198 |
| Sherlock p-value | 0.39 |
| Fetal beta | -0.466 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg23379540 | 12 | 51611600 | POU6F1 | 2.61E-5 | -0.49 | 0.017 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FMR1 | 0.87 | 0.87 |
| ACBD5 | 0.87 | 0.85 |
| RAB21 | 0.86 | 0.86 |
| HDHD2 | 0.84 | 0.83 |
| CCDC47 | 0.84 | 0.86 |
| DLD | 0.83 | 0.81 |
| FBXL3 | 0.82 | 0.83 |
| AGGF1 | 0.82 | 0.81 |
| SENP2 | 0.82 | 0.83 |
| RABL3 | 0.82 | 0.80 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.21 | -0.64 | -0.40 |
| IL32 | -0.59 | -0.48 |
| C1orf61 | -0.58 | -0.53 |
| C1orf54 | -0.58 | -0.42 |
| VAMP5 | -0.56 | -0.40 |
| IFI27 | -0.54 | -0.41 |
| CLEC3B | -0.53 | -0.48 |
| ENHO | -0.53 | -0.52 |
| APOC1 | -0.53 | -0.40 |
| C16orf74 | -0.52 | -0.46 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003700 | transcription factor activity | TAS | 7908264 | |
| GO:0043565 | sequence-specific DNA binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007420 | brain development | TAS | Brain (GO term level: 7) | 7908264 |
| GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
| GO:0007517 | muscle development | TAS | 7908264 | |
| GO:0007507 | heart development | TAS | 7908264 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN | 126 | 86 | All SZGR 2.0 genes in this pathway |
| MULLIGHAN NPM1 SIGNATURE 3 DN | 162 | 116 | All SZGR 2.0 genes in this pathway |
| BERENJENO TRANSFORMED BY RHOA DN | 394 | 258 | All SZGR 2.0 genes in this pathway |
| RIZ ERYTHROID DIFFERENTIATION 12HR | 43 | 35 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| GROSS HYPOXIA VIA HIF1A DN | 110 | 78 | All SZGR 2.0 genes in this pathway |
| MORI MATURE B LYMPHOCYTE UP | 90 | 62 | All SZGR 2.0 genes in this pathway |
| SHIPP DLBCL VS FOLLICULAR LYMPHOMA DN | 45 | 28 | All SZGR 2.0 genes in this pathway |
| GOLDRATH IMMUNE MEMORY | 65 | 42 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER NORMAL LIKE UP | 476 | 285 | All SZGR 2.0 genes in this pathway |
| CONRAD STEM CELL | 39 | 27 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 36HR UP | 221 | 150 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES ICP WITH H3K27ME3 | 42 | 27 | All SZGR 2.0 genes in this pathway |
| SENGUPTA EBNA1 ANTICORRELATED | 173 | 85 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 1HR DN | 222 | 147 | All SZGR 2.0 genes in this pathway |
| LI INDUCED T TO NATURAL KILLER DN | 116 | 83 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D | 882 | 506 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-335 | 372 | 378 | m8 | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
| miR-485-5p | 467 | 474 | 1A,m8 | hsa-miR-485-5p | AGAGGCUGGCCGUGAUGAAUUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.