Gene Page: RPRM
Summary ?
| GeneID | 56475 |
| Symbol | RPRM |
| Synonyms | REPRIMO |
| Description | reprimo, TP53 dependent G2 arrest mediator candidate |
| Reference | MIM:612171|HGNC:HGNC:24201|Ensembl:ENSG00000177519|HPRD:18002|Vega:OTTHUMG00000131905 |
| Gene type | protein-coding |
| Map location | 2q23.3 |
| Pascal p-value | 0.796 |
| Sherlock p-value | 0.659 |
| Fetal beta | 1.818 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 | |
| Expression | Meta-analysis of gene expression | P value: 1.466 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg25925441 | 2 | 154336045 | RPRM | 1.034E-4 | 0.339 | 0.028 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 17353931 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007346 | regulation of mitotic cell cycle | IEA | - | |
| GO:0007050 | cell cycle arrest | TAS | 10930422 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005737 | cytoplasm | TAS | 10930422 | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG P53 SIGNALING PATHWAY | 69 | 45 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| PACHER TARGETS OF IGF1 AND IGF2 UP | 35 | 27 | All SZGR 2.0 genes in this pathway |
| MARKEY RB1 CHRONIC LOF UP | 115 | 78 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER UP | 227 | 137 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS STEM CELL LONG TERM | 302 | 191 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 2 | 50 | 34 | All SZGR 2.0 genes in this pathway |
| SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
| WANG LSD1 TARGETS UP | 24 | 14 | All SZGR 2.0 genes in this pathway |
| MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
| CHENG IMPRINTED BY ESTRADIOL | 110 | 68 | All SZGR 2.0 genes in this pathway |
| TAYLOR METHYLATED IN ACUTE LYMPHOBLASTIC LEUKEMIA | 77 | 52 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS UP | 491 | 316 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS 36HR UP | 221 | 150 | All SZGR 2.0 genes in this pathway |
| ZHANG TLX TARGETS UP | 108 | 78 | All SZGR 2.0 genes in this pathway |
| MCMURRAY TP53 HRAS COOPERATION RESPONSE DN | 67 | 46 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| CAIRO LIVER DEVELOPMENT UP | 166 | 105 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 0 | 76 | 54 | All SZGR 2.0 genes in this pathway |
| SASSON RESPONSE TO GONADOTROPHINS DN | 87 | 66 | All SZGR 2.0 genes in this pathway |
| SASSON RESPONSE TO FORSKOLIN DN | 88 | 68 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE MIDDLE | 98 | 56 | All SZGR 2.0 genes in this pathway |
| PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
| MALIK REPRESSED BY ESTROGEN | 12 | 10 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-203.1 | 865 | 871 | m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
| miR-335 | 815 | 822 | 1A,m8 | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.