Gene Page: RARS
Summary ?
GeneID | 5917 |
Symbol | RARS |
Synonyms | ArgRS|DALRD1|HLD9 |
Description | arginyl-tRNA synthetase |
Reference | MIM:107820|HGNC:HGNC:9870|Ensembl:ENSG00000113643|HPRD:00142|Vega:OTTHUMG00000130411 |
Gene type | protein-coding |
Map location | 5q35.1 |
Pascal p-value | 0.104 |
Sherlock p-value | 0.569 |
DMG | 1 (# studies) |
eGene | Cerebellar Hemisphere Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.0276 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
RARS | chr5 | 167921598 | A | G | NM_002887 | . | silent | Schizophrenia | DNM:Gulsuner_2013 |
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg24309730 | 5 | 167913298 | RARS | 4.77E-11 | -0.017 | 3.89E-7 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ZNF488 | 0.63 | 0.64 |
RIN1 | 0.62 | 0.58 |
KCNG2 | 0.62 | 0.52 |
VWA5B2 | 0.61 | 0.59 |
TNFRSF14 | 0.60 | 0.59 |
HIPK4 | 0.60 | 0.61 |
GLIS1 | 0.60 | 0.55 |
RHPN1 | 0.59 | 0.56 |
KCNH3 | 0.59 | 0.58 |
AGFG2 | 0.58 | 0.58 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FAM36A | -0.41 | -0.43 |
RBMX2 | -0.40 | -0.49 |
IDH1 | -0.40 | -0.41 |
TUBB2B | -0.40 | -0.41 |
YBX1 | -0.39 | -0.44 |
C11orf57 | -0.39 | -0.48 |
KIAA1949 | -0.39 | -0.39 |
FNBP1L | -0.39 | -0.37 |
RP9 | -0.39 | -0.48 |
GTF3C6 | -0.39 | -0.44 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005515 | protein binding | IPI | 17353931 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0004814 | arginine-tRNA ligase activity | IEA | - | |
GO:0016874 | ligase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006420 | arginyl-tRNA aminoacylation | TAS | 7590355 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005625 | soluble fraction | TAS | 7590355 | |
GO:0005634 | nucleus | IDA | 18029348 | |
GO:0005730 | nucleolus | IDA | 18029348 | |
GO:0005737 | cytoplasm | TAS | 7590355 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG AMINOACYL TRNA BIOSYNTHESIS | 41 | 33 | All SZGR 2.0 genes in this pathway |
REACTOME CYTOSOLIC TRNA AMINOACYLATION | 24 | 19 | All SZGR 2.0 genes in this pathway |
REACTOME TRNA AMINOACYLATION | 42 | 34 | All SZGR 2.0 genes in this pathway |
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER UP | 206 | 111 | All SZGR 2.0 genes in this pathway |
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
BORCZUK MALIGNANT MESOTHELIOMA UP | 305 | 185 | All SZGR 2.0 genes in this pathway |
WANG CLIM2 TARGETS DN | 186 | 114 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP | 722 | 443 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA UP | 536 | 340 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 DN | 156 | 106 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 AND HIF1A UP | 142 | 104 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST DN | 309 | 206 | All SZGR 2.0 genes in this pathway |
NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE UP | 157 | 105 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE DN | 245 | 154 | All SZGR 2.0 genes in this pathway |
LEI MYB TARGETS | 318 | 215 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE DN | 123 | 76 | All SZGR 2.0 genes in this pathway |
GENTILE UV RESPONSE CLUSTER D7 | 40 | 21 | All SZGR 2.0 genes in this pathway |
GENTILE UV HIGH DOSE DN | 312 | 203 | All SZGR 2.0 genes in this pathway |
ZAMORA NOS2 TARGETS DN | 96 | 71 | All SZGR 2.0 genes in this pathway |
WELCSH BRCA1 TARGETS DN | 141 | 92 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
IRITANI MAD1 TARGETS DN | 47 | 30 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14 | 143 | 86 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-219 | 65 | 71 | 1A | hsa-miR-219brain | UGAUUGUCCAAACGCAAUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.