Summary ?
GeneID6601
SymbolSMARCC2
SynonymsBAF170|CRACC2|Rsc8
DescriptionSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
ReferenceMIM:601734|HGNC:HGNC:11105|Ensembl:ENSG00000139613|HPRD:03437|Vega:OTTHUMG00000170288
Gene typeprotein-coding
Map location12q13.2
Pascal p-value0.355
Sherlock p-value0.08
TADA p-value0.003
Fetal beta-0.528
DMG1 (# studies)
eGeneMyers' cis & trans
SupportCompositeSet
Darnell FMRP targets
Chromatin Remodeling Genes

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
DNM:Fromer_2014Whole Exome Sequencing analysisThis study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0178 

Section I. Genetics and epigenetics annotation

@DNM table

GeneChromosomePositionRefAltTranscriptAA changeMutation typeSiftCG46TraitStudy
SMARCC2chr1256566768..56566770CTTCNM_001130420
NM_003075
NM_139067
.
.
.
frameshift
intronic
frameshift
SchizophreniaDNM:Fromer_2014

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg019827881256556339SMARCC24.872E-40.3420.047DMG:Wockner_2014

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs163562chr33085003SMARCC266010.17trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
SSPN0.840.84
PDLIM50.840.87
AQP40.810.77
TIMP30.810.83
MTM10.800.79
EDNRB0.790.69
FIBIN0.770.77
MYOM10.760.79
TMEM470.760.78
SPATA60.740.74
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
NR2C2AP-0.40-0.48
PLEKHO1-0.39-0.44
COMMD3-0.38-0.49
SLA-0.37-0.25
IER5L-0.37-0.33
MPPED1-0.37-0.32
ISLR2-0.37-0.27
AC011491.1-0.37-0.43
AC132872.1-0.36-0.50
SNHG12-0.36-0.53

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0003682chromatin bindingIEA-
GO:0003713transcription coactivator activityTAS8804307 
GO:0008022protein C-terminus bindingIPI12917342 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006333chromatin assembly or disassemblyIEA-
GO:0006357regulation of transcription from RNA polymerase II promoterTAS8804307 
GO:0006350transcriptionIEA-
GO:0006338chromatin remodelingIDA10078207 |11018012 
GO:0045892negative regulation of transcription, DNA-dependentIDA12192000 
GO:0045893positive regulation of transcription, DNA-dependentIDA11018012 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0000785chromatinIEA-
GO:0005622intracellularIEA-
GO:0005634nucleusIEA-
GO:0005654nucleoplasmTAS8804307 
GO:0017053transcriptional repressor complexIPI12192000 
GO:0016514SWI/SNF complexIDA10078207 

Section IV. Protein-protein interaction annotation

InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTBPS1TP5BP1actin, betaAffinity Capture-WesternBioGRID9845365 
ARRB2ARB2 | ARR2 | BARR2 | DKFZp686L0365arrestin, beta 2Two-hybridBioGRID16169070 
BAZ1BWBSCR10 | WBSCR9 | WSTFbromodomain adjacent to zinc finger domain, 1B-HPRD,BioGRID12837248 
BRCA1BRCAI | BRCC1 | IRIS | PSCP | RNF53breast cancer 1, early onsetCo-purificationBioGRID10943845 
CDK8K35 | MGC126074 | MGC126075cyclin-dependent kinase 8Co-fractionationBioGRID9710619 
GATA1ERYF1 | GF-1 | GF1 | NFE1GATA binding protein 1 (globin transcription factor 1)Reconstituted ComplexBioGRID11018012 
GRM2GLUR2 | GPRC1B | MGLUR2 | mGlu2glutamate receptor, metabotropic 2BAF170 interacts with mGluR2 promoter.BIND15035981 
HSP90B1ECGP | GP96 | GRP94 | TRA1heat shock protein 90kDa beta (Grp94), member 1Affinity Capture-WesternBioGRID11726552 
ING1p24ING1c | p33 | p33ING1 | p33ING1b | p47 | p47ING1ainhibitor of growth family, member 1Affinity Capture-MSBioGRID11784859 
ITSN1ITSN | MGC134948 | MGC134949 | SH3D1A | SH3P17intersectin 1 (SH3 domain protein)Two-hybridBioGRID16169070 
KLF1EKLFKruppel-like factor 1 (erythroid)Reconstituted ComplexBioGRID11018012 
MAP3K3MAPKKK3 | MEKK3mitogen-activated protein kinase kinase kinase 3-HPRD14743216 
NCOR1KIAA1047 | MGC104216 | N-CoR | TRAC1 | hCIT529I10 | hN-CoRnuclear receptor co-repressor 1Co-purificationBioGRID11013263 
PEX14MGC12767 | NAPP2 | Pex14p | dJ734G22.2peroxisomal biogenesis factor 14Two-hybridBioGRID16169070 
PHYHIPDYRK1AP3 | KIAA0273 | PAHX-AP | PAHXAP1phytanoyl-CoA 2-hydroxylase interacting proteinTwo-hybridBioGRID16169070 
POLR2AMGC75453 | POLR2 | POLRA | RPB1 | RPBh1 | RPO2 | RPOL2 | RpIILS | hRPB220 | hsRPB1polymerase (RNA) II (DNA directed) polypeptide A, 220kDa-HPRD9710619 
POLR2CRPB3 | RPB31 | hRPB33 | hsRPB3polymerase (RNA) II (DNA directed) polypeptide C, 33kDaTwo-hybridBioGRID16169070 
RELBI-REL | IRELv-rel reticuloendotheliosis viral oncogene homolog B-HPRD,BioGRID14743216 
SMARCA2BAF190 | BRM | FLJ36757 | MGC74511 | SNF2 | SNF2L2 | SNF2LA | SWI2 | Sth1p | hBRM | hSNF2aSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2Co-purificationBioGRID8895581 
SMARCA4BAF190 | BRG1 | FLJ39786 | SNF2 | SNF2-BETA | SNF2L4 | SNF2LB | SWI2 | hSNF2bSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4Affinity Capture-Western
Co-purification
BioGRID8895581 |9845365 
|11726552 
SMARCB1BAF47 | INI1 | RDT | SNF5 | SNF5L1 | Sfh1p | Snr1 | hSNFSSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1Co-purificationBioGRID8895581 
SMARCD1BAF60A | CRACD1 | Rsc6pSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1Affinity Capture-WesternBioGRID12917342 
SMARCE1BAF57SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1Affinity Capture-WesternBioGRID9845365 
SP1-Sp1 transcription factorReconstituted ComplexBioGRID11018012 
SRGAP3ARHGAP14 | KIAA0411 | MEGAP | SRGAP2 | WRPSLIT-ROBO Rho GTPase activating protein 3-HPRD12368262 
STAT2ISGF-3 | MGC59816 | P113 | STAT113signal transducer and activator of transcription 2, 113kDaAffinity Capture-WesternBioGRID12244326 
STMN2SCG10 | SCGN10 | SGC10stathmin-like 2BAF170 interacts with SCG10 promoter.BIND15035981 


Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
PID REG GR PATHWAY 8260All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP 1382904All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP 380215All SZGR 2.0 genes in this pathway
LAIHO COLORECTAL CANCER SERRATED DN 8647All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER DN 406230All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN 536332All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS 957597All SZGR 2.0 genes in this pathway
STARK PREFRONTAL CORTEX 22Q11 DELETION UP 195138All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE INCIPIENT UP 390242All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 16911088All SZGR 2.0 genes in this pathway
LEE AGING MUSCLE UP 4533All SZGR 2.0 genes in this pathway
MALONEY RESPONSE TO 17AAG UP 4126All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP 682440All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1502202261Ahsa-miR-150UCUCCCAACCCUUGUACCAGUG