SZGR2

Summary ?

GeneID	6667
Symbol	SP1
Synonyms	-
Description	Sp1 transcription factor
Reference	MIM:189906\|HGNC:HGNC:11205\|Ensembl:ENSG00000185591\|HPRD:01796\|Vega:OTTHUMG00000170047
Gene type	protein-coding
Map location	12q13.1
Pascal p-value	0.043
Sherlock p-value	0.392
Fetal beta	0.532
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias	Click to show details
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0366

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs16829545	chr2	151977407	SP1	6667		0.05		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003690	double-stranded DNA binding	IEA		-
GO:0003700	transcription factor activity	IDA		12560508
GO:0003702	RNA polymerase II transcription factor activity	NAS		3139301
GO:0008270	zinc ion binding	IEA		-
GO:0008022	protein C-terminus binding	IPI		10816420
GO:0016563	transcription activator activity	IDA		14580349
GO:0042803	protein homodimerization activity	IDA		10393239
GO:0046872	metal ion binding	IEA		-
GO:0043565	sequence-specific DNA binding	IDA		12169688
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006350	transcription	IEA		-
GO:0045893	positive regulation of transcription, DNA-dependent	IDA		14580349
GO:0045817	positive regulation of transcription from RNA polymerase II promoter, global	IDA		12169688
GO:0044419	interspecies interaction between organisms	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IC		3139301
GO:0005730	nucleolus	IDA		18029348
GO:0005737	cytoplasm	IDA		18029348

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AATF	CHE-1 \| CHE1 \| DED	apoptosis antagonizing transcription factor	-	HPRD,BioGRID	12847090
AHR	-	aryl hydrocarbon receptor	-	HPRD,BioGRID	10471301 \|12612060
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	Affinity Capture-Western	BioGRID	15661808
ARNT	HIF-1beta \| HIF1B \| HIF1BETA \| TANGO \| bHLHe2	aryl hydrocarbon receptor nuclear translocator	Reconstituted Complex	BioGRID	10471301
ATF7IP	FLJ10139 \| FLJ10688 \| MCAF \| p621	activating transcription factor 7 interacting protein	MCAF1 interacts with Sp1.	BIND	15691849
ATF7IP2	FLJ12668 \| MCAF2	activating transcription factor 7 interacting protein 2	MCAF2 interacts with Sp1.	BIND	15691849
BCL6	BCL5 \| BCL6A \| LAZ3 \| ZBTB27 \| ZNF51	B-cell CLL/lymphoma 6	-	HPRD	12004059
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	-	HPRD	10720440
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	BRCA1 interacts with Sp1.	BIND	12706836
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	Affinity Capture-Western	BioGRID	12706836
C14orf106	FLJ11186 \| HSA242977 \| KIAA1903 \| MIS18BP1	chromosome 14 open reading frame 106	-	HPRD	10976766
CD2	SRBC \| T11	CD2 molecule	-	HPRD	7933095
CD209	CDSIGN \| CLEC4L \| DC-SIGN \| DC-SIGN1 \| MGC129965	CD209 molecule	Sp1 interacts with the CD209 promoter.	BIND	15838506
CDC25C	CDC25	cell division cycle 25 homolog C (S. pombe)	Sp1 interacts with the cdc25c promoter.	BIND	15574328
CDKN1A	CAP20 \| CDKN1 \| CIP1 \| MDA-6 \| P21 \| SDI1 \| WAF1 \| p21CIP1	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	SP1 interacts with the CDKN1A (p21) promoter.	BIND	15674334
CDKN1A	CAP20 \| CDKN1 \| CIP1 \| MDA-6 \| P21 \| SDI1 \| WAF1 \| p21CIP1	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	Sp1 interacts with CDKN1A promoter.	BIND	15780936
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	-	HPRD,BioGRID	12847250
CLCN1	CLC1 \| MGC138361 \| MGC142055	chloride channel 1, skeletal muscle	p-CLCN1 interacts with Sp1.	BIND	14657503
DMPK	DM \| DM1 \| DM1PK \| DMK \| MDPK \| MT-PK	dystrophia myotonica-protein kinase	Mutant DMPK mRNA interacts with Sp1.	BIND	14657503
E2F1	E2F-1 \| RBAP1 \| RBBP3 \| RBP3	E2F transcription factor 1	-	HPRD,BioGRID	10547281
E2F2	E2F-2	E2F transcription factor 2	-	HPRD	8657141 \|8657142 \|9694791
E2F3	DKFZp686C18211 \| E2F-3 \| KIAA0075 \| MGC104598	E2F transcription factor 3	-	HPRD	8657141
EGR1	AT225 \| G0S30 \| KROX-24 \| NGFI-A \| TIS8 \| ZIF-268 \| ZNF225	early growth response 1	Egr1 interacts with Sp1.This interaction was modelled on a demonstrated interaction between human Egr1 and mouse Sp1.	BIND	12569082
ELF1	-	E74-like factor 1 (ets domain transcription factor)	-	HPRD,BioGRID	10976766
GABPA	E4TF1-60 \| E4TF1A \| NFT2 \| NRF2 \| NRF2A	GA binding protein transcription factor, alpha subunit 60kDa	-	HPRD,BioGRID	11237613
GATA1	ERYF1 \| GF-1 \| GF1 \| NFE1	GATA binding protein 1 (globin transcription factor 1)	Reconstituted Complex	BioGRID	12239153
GRIN1	NMDA1 \| NMDAR1 \| NR1	glutamate receptor, ionotropic, N-methyl D-aspartate 1	-	HPRD	14970236
HCFC1	CFF \| HCF-1 \| HCF1 \| HFC1 \| MGC70925 \| VCAF	host cell factor C1 (VP16-accessory protein)	-	HPRD,BioGRID	10976766 \|12670868
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	Affinity Capture-Western	BioGRID	11896613 \|12091390 \|12176973 \|12847090
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	-	HPRD	11896613 \|11909966
HDAC2	RPD3 \| YAF1	histone deacetylase 2	-	HPRD,BioGRID	12151407
HIF1A	HIF-1alpha \| HIF1 \| HIF1-ALPHA \| MOP1 \| PASD8	hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	Sp1 interacts with HIF-1alpha.	BIND	15780936
HMGA1	HMG-R \| HMGA1A \| HMGIY \| MGC12816 \| MGC4242 \| MGC4854	high mobility group AT-hook 1	-	HPRD,BioGRID	12665574
HSPA8	HSC54 \| HSC70 \| HSC71 \| HSP71 \| HSP73 \| HSPA10 \| LAP1 \| MGC131511 \| MGC29929 \| NIP71	heat shock 70kDa protein 8	-	HPRD	10976766
HTT	HD \| IT15	huntingtin	-	HPRD,BioGRID	11839795
HTT	HD \| IT15	huntingtin	Huntingtin interacts with Sp1. This interaction was modelled on a demonstrated interaction between Huntingtin from human and Sp1 from rat.	BIND	11839795
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	-	HPRD,BioGRID	10506225
KLF10	EGRA \| TIEG \| TIEG1	Kruppel-like factor 10	-	HPRD,BioGRID	10976766
KLF4	EZF \| GKLF	Kruppel-like factor 4 (gut)	-	HPRD,BioGRID	9651398 \|12034813
KLF6	BCD1 \| COPEB \| CPBP \| DKFZp686N0199 \| GBF \| PAC1 \| ST12 \| ZF9	Kruppel-like factor 6	-	HPRD,BioGRID	12433697
LDB1	CLIM2 \| NLI	LIM domain binding 1	Reconstituted Complex	BioGRID	12239153
LMO2	RBTN2 \| RBTNL1 \| RHOM2 \| TTG2	LIM domain only 2 (rhombotin-like 1)	Reconstituted Complex	BioGRID	12239153
MDM2	HDMX \| MGC71221 \| hdm2	Mdm2 p53 binding protein homolog (mouse)	SP1 interacts with the MDM2 intronic promoter.	BIND	15550242
MEF2C	-	myocyte enhancer factor 2C	-	HPRD,BioGRID	9748305
MEF2D	DKFZp686I1536	myocyte enhancer factor 2D	-	HPRD,BioGRID	12213324
MIER1	DKFZp781G0451 \| ER1 \| KIAA1610 \| MGC131940 \| MGC150640 \| MGC150641 \| MI-ER1 \| RP5-944N15.1 \| hMI-ER1	mesoderm induction early response 1 homolog (Xenopus laevis)	-	HPRD	15117948
MSX1	HOX7 \| HYD1	msh homeobox 1	-	HPRD,BioGRID	10215616
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	Myc interacts with Sp1. This interaction was modeled on a demonstrated interaction between mouse Myc and human Sp-1.	BIND	11274368
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	Sp1 interacts with Myc.	BIND	15780936
MYC	bHLHe39 \| c-Myc	v-myc myelocytomatosis viral oncogene homolog (avian)	-	HPRD,BioGRID	11274368
MYOD1	MYF3 \| MYOD \| PUM \| bHLHc1	myogenic differentiation 1	-	HPRD,BioGRID	10082523
MYOG	MYF4 \| MYOGENIN \| bHLHc3	myogenin (myogenic factor 4)	-	HPRD,BioGRID	10082523
NCL	C23 \| FLJ45706	nucleolin	Affinity Capture-Western	BioGRID	14623863
NFKB1	DKFZp686C01211 \| EBP-1 \| KBF1 \| MGC54151 \| NF-kappa-B \| NFKB-p105 \| NFKB-p50 \| p105	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	Reconstituted Complex	BioGRID	7933095
NFKB2	LYT-10 \| LYT10	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	Reconstituted Complex	BioGRID	7933095
NOS3	ECNOS \| eNOS	nitric oxide synthase 3 (endothelial cell)	-	HPRD	7541039
NR2F1	COUP-TFI \| EAR-3 \| EAR3 \| ERBAL3 \| NR2F2 \| SVP44 \| TCFCOUP1 \| TFCOUP1	nuclear receptor subfamily 2, group F, member 1	-	HPRD,BioGRID	9388268
NR5A1	AD4BP \| ELP \| FTZ1 \| FTZF1 \| SF-1 \| SF1	nuclear receptor subfamily 5, group A, member 1	-	HPRD,BioGRID	10919277
PGR	NR3C3 \| PR	progesterone receptor	Sp1 interacts with the PgRA promoter.	BIND	15019994
PGR	NR3C3 \| PR	progesterone receptor	Sp1 interacts with the PgRB promoter.	BIND	15019994
PML	MYL \| PP8675 \| RNF71 \| TRIM19	promyelocytic leukemia	-	HPRD,BioGRID	9819401
POGZ	KIAA0461 \| MGC71543 \| SUHW5 \| ZNF280E \| ZNF635 \| ZNF635m	pogo transposable element with ZNF domain	-	HPRD,BioGRID	10976766
POU2F1	OCT1 \| OTF1	POU class 2 homeobox 1	-	HPRD,BioGRID	8668525
PPP1R13L	IASPP \| NKIP1 \| RAI	protein phosphatase 1, regulatory (inhibitor) subunit 13 like	-	HPRD,BioGRID	12134007
PSIP1	DFS70 \| LEDGF \| MGC74712 \| PAIP \| PSIP2 \| p52 \| p75	PC4 and SFRS1 interacting protein 1	Reconstituted Complex	BioGRID	9885563
PSMC5	S8 \| SUG1 \| TBP10 \| TRIP1 \| p45 \| p45/SUG	proteasome (prosome, macropain) 26S subunit, ATPase, 5	-	HPRD,BioGRID	10816420
PURA	PUR-ALPHA \| PUR1 \| PURALPHA	purine-rich element binding protein A	-	HPRD,BioGRID	10457364
RARA	NR1B1 \| RAR	retinoic acid receptor, alpha	Reconstituted Complex	BioGRID	10361124
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	-	HPRD	7732011
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	Affinity Capture-Western	BioGRID	11896613
RBBP4	NURF55 \| RBAP48	retinoblastoma binding protein 4	-	HPRD,BioGRID	12091390 \|12943729
RECQL4	RECQ4	RecQ protein-like 4	SP1 interacts with the RECQL4 (RECQ4) promoter.	BIND	15674334
REL	C-Rel	v-rel reticuloendotheliosis viral oncogene homolog (avian)	-	HPRD,BioGRID	7933095
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	-	HPRD	7933095\|12055073
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	Affinity Capture-Western Reconstituted Complex	BioGRID	7933095 \|12055073
RNASEN	DROSHA \| ETOHI2 \| HSA242976 \| RANSE3L \| RN3 \| RNASE3L	ribonuclease type III, nuclear	-	HPRD	10976766
RNF4	RES4-26 \| SNURF	ring finger protein 4	Affinity Capture-Western	BioGRID	10617653
RXRA	FLJ00280 \| FLJ00318 \| FLJ16020 \| FLJ16733 \| MGC102720 \| NR2B1	retinoid X receptor, alpha	Reconstituted Complex	BioGRID	10361124
SF3A1	PRP21 \| PRPF21 \| SAP114 \| SF3A120	splicing factor 3a, subunit 1, 120kDa	-	HPRD	10976766
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	-	HPRD	7933095
SKIV2L2	Dob1 \| KIAA0052 \| MGC142069 \| Mtr4 \| fSAP118	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	-	HPRD	14676314
SMAD2	JV18 \| JV18-1 \| MADH2 \| MADR2 \| MGC22139 \| MGC34440 \| hMAD-2 \| hSMAD2	SMAD family member 2	-	HPRD,BioGRID	11114293
SMAD3	DKFZp586N0721 \| DKFZp686J10186 \| HSPC193 \| HsT17436 \| JV15-2 \| MADH3 \| MGC60396	SMAD family member 3	Affinity Capture-Western	BioGRID	11114293 \|11432852
SMAD4	DPC4 \| JIP \| MADH4	SMAD family member 4	-	HPRD	11432852
SMARCA4	BAF190 \| BRG1 \| FLJ39786 \| SNF2 \| SNF2-BETA \| SNF2L4 \| SNF2LB \| SWI2 \| hSNF2b	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	Reconstituted Complex	BioGRID	11018012
SMARCC1	BAF155 \| CRACC1 \| Rsc8 \| SRG3 \| SWI3	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	Reconstituted Complex	BioGRID	11018012
SMARCC2	BAF170 \| CRACC2 \| Rsc8	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	Reconstituted Complex	BioGRID	11018012
SP3	DKFZp686O1631 \| SPR-2	Sp3 transcription factor	-	HPRD	9329821
SP4	HF1B \| MGC130008 \| MGC130009 \| SPR-1	Sp4 transcription factor	-	HPRD,BioGRID	7559627
SREBF1	SREBP-1c \| SREBP1 \| bHLHd1	sterol regulatory element binding transcription factor 1	-	HPRD,BioGRID	10224053
SREBF2	SREBP2 \| bHLHd2	sterol regulatory element binding transcription factor 2	-	HPRD,BioGRID	10976766
SRF	MCM1	serum response factor (c-fos serum response element-binding transcription factor)	Reconstituted Complex	BioGRID	10082523
SUB1	MGC102747 \| P15 \| PC4 \| p14	SUB1 homolog (S. cerevisiae)	Reconstituted Complex	BioGRID	9885563
TAF4	FLJ41943 \| TAF2C \| TAF2C1 \| TAF4A \| TAFII130 \| TAFII135	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	-	HPRD,BioGRID	9742090
TAL1	SCL \| TCL5 \| bHLHa17 \| tal-1	T-cell acute lymphocytic leukemia 1	-	HPRD,BioGRID	12239153
TNFSF10	APO2L \| Apo-2L \| CD253 \| TL2 \| TRAIL	tumor necrosis factor (ligand) superfamily, member 10	SP1 interacts with the TNFSF10 promoter.	BIND	15619633
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	p53 interacts with Sp1.	BIND	15574328
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	p53 interacts with Sp1.	BIND	9492043
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	TP53 (p53) interacts with Sp1.	BIND	9685344
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	TP53 (p53) interacts with SP1.	BIND	15674334
YY1	DELTA \| INO80S \| NF-E1 \| UCRBP \| YIN-YANG-1	YY1 transcription factor	Affinity Capture-Western	BioGRID	10224053
YY1	DELTA \| INO80S \| NF-E1 \| UCRBP \| YIN-YANG-1	YY1 transcription factor	YY1 interacts with Sp1.	BIND	8327494
ZBTB16	PLZF \| ZNF145	zinc finger and BTB domain containing 16	-	HPRD	12004059
ZBTB7A	DKFZp547O146 \| FBI-1 \| FBI1 \| LRF \| MGC99631 \| ZBTB7 \| ZNF857A \| pokemon	zinc finger and BTB domain containing 7A	-	HPRD	12004059

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG TGF BETA SIGNALING PATHWAY	86	64	All SZGR 2.0 genes in this pathway
KEGG HUNTINGTONS DISEASE	185	109	All SZGR 2.0 genes in this pathway
BIOCARTA AGR PATHWAY	36	31	All SZGR 2.0 genes in this pathway
BIOCARTA CALCINEURIN PATHWAY	21	17	All SZGR 2.0 genes in this pathway
BIOCARTA HCMV PATHWAY	17	16	All SZGR 2.0 genes in this pathway
BIOCARTA KERATINOCYTE PATHWAY	46	38	All SZGR 2.0 genes in this pathway
BIOCARTA MAPK PATHWAY	87	68	All SZGR 2.0 genes in this pathway
BIOCARTA PPARA PATHWAY	58	43	All SZGR 2.0 genes in this pathway
PID SMAD2 3NUCLEAR PATHWAY	82	63	All SZGR 2.0 genes in this pathway
PID P73PATHWAY	79	59	All SZGR 2.0 genes in this pathway
PID IL4 2PATHWAY	65	43	All SZGR 2.0 genes in this pathway
PID E2F PATHWAY	74	48	All SZGR 2.0 genes in this pathway
PID HIF2PATHWAY	34	29	All SZGR 2.0 genes in this pathway
PID FRA PATHWAY	37	28	All SZGR 2.0 genes in this pathway
PID TELOMERASE PATHWAY	68	48	All SZGR 2.0 genes in this pathway
PID HNF3B PATHWAY	45	37	All SZGR 2.0 genes in this pathway
PID P53 DOWNSTREAM PATHWAY	137	94	All SZGR 2.0 genes in this pathway
PID AP1 PATHWAY	70	60	All SZGR 2.0 genes in this pathway
PID FOXM1 PATHWAY	40	30	All SZGR 2.0 genes in this pathway
PID CMYB PATHWAY	84	61	All SZGR 2.0 genes in this pathway
PID IL2 STAT5 PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID MYC REPRESS PATHWAY	63	52	All SZGR 2.0 genes in this pathway
PID HIF1 TFPATHWAY	66	52	All SZGR 2.0 genes in this pathway
PID TAP63 PATHWAY	54	40	All SZGR 2.0 genes in this pathway
PID HNF3A PATHWAY	44	29	All SZGR 2.0 genes in this pathway
REACTOME SMAD2 SMAD3 SMAD4 HETEROTRIMER REGULATES TRANSCRIPTION	27	17	All SZGR 2.0 genes in this pathway
REACTOME TRANSCRIPTIONAL ACTIVITY OF SMAD2 SMAD3 SMAD4 HETEROTRIMER	38	26	All SZGR 2.0 genes in this pathway
REACTOME GENERIC TRANSCRIPTION PATHWAY	352	181	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY TGF BETA RECEPTOR COMPLEX	63	42	All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP	423	283	All SZGR 2.0 genes in this pathway
GINESTIER BREAST CANCER ZNF217 AMPLIFIED UP	78	48	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN	805	505	All SZGR 2.0 genes in this pathway
TURJANSKI MAPK1 AND MAPK2 TARGETS	12	10	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK	101	73	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
COLLIS PRKDC SUBSTRATES	20	15	All SZGR 2.0 genes in this pathway
SASAKI ADULT T CELL LEUKEMIA	176	122	All SZGR 2.0 genes in this pathway
GUO HEX TARGETS UP	81	54	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP	314	201	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS DN	120	81	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
LEE DIFFERENTIATING T LYMPHOCYTE	200	115	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE S	162	86	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN	553	343	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B	517	302	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	524	530	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	524	530	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
				hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
				hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-125/351	3141	3147	1A	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	3141	3147	1A	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-128	4516	4522	m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
				hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
				hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
				hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-135	344	350	m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	344	350	m8	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-149	3809	3815	m8	hsa-miR-149^brain	UCUGGCUCCGUGUCUUCACUCC
miR-193	3811	3817	1A	hsa-miR-193a	AACUGGCCUACAAAGUCCCAG
miR-193	3811	3817	1A	hsa-miR-193b	AACUGGCCCUCAAAGUCCCGCUUU
miR-214	3918	3924	1A	hsa-miR-214^brain	ACAGCAGGCACAGACAGGCAG
miR-218	1405	1411	m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-22	4733	4739	m8	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-24	542	548	m8	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-25/32/92/363/367	1779	1785	1A	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-27	1663	1669	m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	1663	1669	m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-29	3168	3174	1A	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
				hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-326	17	23	1A	hsa-miR-326	CCUCUGGGCCCUUCCUCCAG
miR-33	1580	1586	1A	hsa-miR-33	GUGCAUUGUAGUUGCAUUG
miR-33	1580	1586	1A	hsa-miR-33b	GUGCAUUGCUGUUGCAUUGCA
miR-330	4035	4041	1A	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-335	4579	4586	1A,m8	hsa-miR-335^brain	UCAAGAGCAAUAACGAAAAAUGU
miR-361	3921	3927	1A	hsa-miR-361^brain	UUAUCAGAAUCUCCAGGGGUAC
miR-361	3921	3927	1A	hsa-miR-361^brain	UUAUCAGAAUCUCCAGGGGUAC
miR-369-3p	412	418	1A	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-374	412	418	m8	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-375	1434	1440	1A	hsa-miR-375	UUUGUUCGUUCGGCUCGCGUGA
miR-376	3413	3419	1A	hsa-miR-376a	AUCAUAGAGGAAAAUCCACGU
miR-376	3413	3419	1A	hsa-miR-376b	AUCAUAGAGGAAAAUCCAUGUU
miR-378	2297	2303	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-378	2297	2303	1A	hsa-miR-378	CUCCUGACUCCAGGUCCUGUGU
miR-381	3354	3360	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-410	414	420	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-485-3p	5008	5014	m8	hsa-miR-485-3p	GUCAUACACGGCUCUCCUCUCU
miR-493-5p	5135	5141	1A	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-495	4906	4912	m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-7	1152	1159	1A,m8	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SP1