Gene Page: ACTC1
Summary ?
GeneID | 70 |
Symbol | ACTC1 |
Synonyms | ACTC|ASD5|CMD1R|CMH11|LVNC4 |
Description | actin, alpha, cardiac muscle 1 |
Reference | MIM:102540|HGNC:HGNC:143|Ensembl:ENSG00000159251|HPRD:00015|Vega:OTTHUMG00000129675 |
Gene type | protein-coding |
Map location | 15q14 |
Pascal p-value | 0.006 |
eGene | Meta |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0172 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0005524 | ATP binding | IDA | 16611632 | |
GO:0005198 | structural molecule activity | IEA | - | |
GO:0017022 | myosin binding | IPI | 16611632 | |
GO:0016887 | ATPase activity | IDA | 16611632 |17765196 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0055008 | cardiac muscle morphogenesis | ISS | - | |
GO:0055003 | cardiac myofibril assembly | ISS | - | |
GO:0030240 | muscle thin filament assembly | ISS | - | |
GO:0030048 | actin filament-based movement | IDA | 16611632 | |
GO:0006915 | apoptosis | ISS | - | |
GO:0031032 | actomyosin structure organization | ISS | - | |
GO:0060047 | heart contraction | IMP | 9563954 |17611253 |17947298 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005856 | cytoskeleton | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0031674 | I band | ISS | - | |
GO:0042643 | actomyosin, actin part | IDA | 16611632 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ABLIM3 | HMFN1661 | actin binding LIM protein family, member 3 | - | HPRD,BioGRID | 15337165 |
ABRA | STARS | actin-binding Rho activating protein | - | HPRD | 11983702 |
ACTB | PS1TP5BP1 | actin, beta | - | HPRD | 8913639 |
ACTN4 | ACTININ-4 | DKFZp686K23158 | FSGS | FSGS1 | actinin, alpha 4 | - | HPRD | 12042308 |
ACTR2 | ARP2 | ARP2 actin-related protein 2 homolog (yeast) | - | HPRD,BioGRID | 12019562 |
AFAP1 | AFAP | AFAP-110 | FLJ56849 | actin filament associated protein 1 | Reconstituted Complex | BioGRID | 12134071 |
ANG | ALS9 | HEL168 | MGC22466 | MGC71966 | RNASE4 | RNASE5 | angiogenin, ribonuclease, RNase A family, 5 | - | HPRD | 8127865 |
CAPN1 | CANP | CANP1 | CANPL1 | muCANP | muCL | calpain 1, (mu/I) large subunit | CAPN1 interacts with ACTC. | BIND | 12358155 |
CFL1 | CFL | cofilin 1 (non-muscle) | - | HPRD | 12207032 |
DMD | BMD | CMD3B | DXS142 | DXS164 | DXS206 | DXS230 | DXS239 | DXS268 | DXS269 | DXS270 | DXS272 | dystrophin | - | HPRD | 11997265 |
DYNLL1 | DLC1 | DLC8 | DNCL1 | DNCLC1 | LC8 | LC8a | MGC126137 | MGC126138 | PIN | hdlc1 | dynein, light chain, LC8-type 1 | - | HPRD | 14760703 |
EPB49 | DMT | FLJ78462 | FLJ98848 | erythrocyte membrane protein band 4.9 (dematin) | - | HPRD | 12011427 |
EZR | CVIL | CVL | DKFZp762H157 | FLJ26216 | MGC1584 | VIL2 | ezrin | - | HPRD | 12271120 |
FSCN1 | FLJ38511 | SNL | p55 | fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus) | - | HPRD | 12139639 |
GC | DBP | DBP/GC | VDBG | VDBP | group-specific component (vitamin D binding protein) | - | HPRD,BioGRID | 12452439 |12554937 |
KLHL17 | RP11-54O7.6 | kelch-like 17 (Drosophila) | - | HPRD | 12063253 |
KPTN | 2E4 | kaptin (actin binding protein) | - | HPRD | 12019562 |
LASP1 | Lasp-1 | MLN50 | LIM and SH3 protein 1 | - | HPRD | 9848085 |
MIB2 | FLJ20648 | FLJ39787 | ZZANK1 | ZZZ5 | mindbomb homolog 2 (Drosophila) | - | HPRD | 14507647 |
MYLK | DKFZp686I10125 | FLJ12216 | KRP | MLCK | MLCK1 | MLCK108 | MLCK210 | MSTP083 | MYLK1 | smMLCK | myosin light chain kinase | - | HPRD | 12110694 |
PLEC1 | EBS1 | EBSO | HD1 | PCN | PLEC1b | PLTN | plectin 1, intermediate filament binding protein 500kDa | - | HPRD | 12136158 |
PPP1R9B | FLJ30345 | PPP1R6 | PPP1R9 | SPINO | Spn | protein phosphatase 1, regulatory (inhibitor) subunit 9B | - | HPRD | 12270929|12417592 |
PRKCE | MGC125656 | MGC125657 | PKCE | nPKC-epsilon | protein kinase C, epsilon | - | HPRD | 11968018 |
SCIN | KIAA1905 | scinderin | - | HPRD | 12438125 |
SYNE1 | 8B | CPG2 | DKFZp781J13156 | FLJ30878 | FLJ41140 | KIAA0796 | KIAA1262 | KIAA1756 | MYNE1 | SCAR8 | spectrin repeat containing, nuclear envelope 1 | - | HPRD | 12408964 |
SYNE2 | DKFZp434H2235 | DKFZp686E01115 | DKFZp686H1931 | FLJ11014 | FLJ43727 | FLJ45710 | FLJ46790 | KIAA1011 | NUA | NUANCE | Nesprin-2 | SYNE-2 | spectrin repeat containing, nuclear envelope 2 | - | HPRD,BioGRID | 12118075 |12408964 |
TNNI3K | CARK | MGC142099 | MGC33828 | TNNI3 interacting kinase | - | HPRD,BioGRID | 12721663 |
TWF1 | A6 | MGC23788 | MGC41876 | PTK9 | twinfilin, actin-binding protein, homolog 1 (Drosophila) | - | HPRD | 12207032 |
WAS | IMD2 | THC | WASP | Wiskott-Aldrich syndrome (eczema-thrombocytopenia) | - | HPRD | 12029088 |
WIPF1 | MGC111041 | PRPL-2 | WASPIP | WIP | WAS/WASL interacting protein family, member 1 | - | HPRD | 12029088 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG CARDIAC MUSCLE CONTRACTION | 80 | 51 | All SZGR 2.0 genes in this pathway |
KEGG HYPERTROPHIC CARDIOMYOPATHY HCM | 85 | 65 | All SZGR 2.0 genes in this pathway |
KEGG DILATED CARDIOMYOPATHY | 92 | 68 | All SZGR 2.0 genes in this pathway |
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS DN | 68 | 49 | All SZGR 2.0 genes in this pathway |
PAPASPYRIDONOS UNSTABLE ATEROSCLEROTIC PLAQUE DN | 43 | 29 | All SZGR 2.0 genes in this pathway |
BERENJENO ROCK SIGNALING NOT VIA RHOA DN | 48 | 34 | All SZGR 2.0 genes in this pathway |
RICKMAN HEAD AND NECK CANCER F | 54 | 32 | All SZGR 2.0 genes in this pathway |
BENPORATH ES 1 | 379 | 235 | All SZGR 2.0 genes in this pathway |
AMIT EGF RESPONSE 480 HELA | 164 | 118 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST UP | 398 | 262 | All SZGR 2.0 genes in this pathway |
BHATTACHARYA EMBRYONIC STEM CELL | 89 | 60 | All SZGR 2.0 genes in this pathway |
GUO HEX TARGETS DN | 65 | 36 | All SZGR 2.0 genes in this pathway |
AFFAR YY1 TARGETS UP | 214 | 133 | All SZGR 2.0 genes in this pathway |
LEE AGING NEOCORTEX DN | 80 | 49 | All SZGR 2.0 genes in this pathway |
APRELIKOVA BRCA1 TARGETS | 49 | 33 | All SZGR 2.0 genes in this pathway |
LEE CALORIE RESTRICTION MUSCLE UP | 43 | 33 | All SZGR 2.0 genes in this pathway |
GENTILE UV HIGH DOSE DN | 312 | 203 | All SZGR 2.0 genes in this pathway |
TSENG IRS1 TARGETS DN | 135 | 88 | All SZGR 2.0 genes in this pathway |
GENTILE UV HIGH DOSE UP | 25 | 13 | All SZGR 2.0 genes in this pathway |
KUNINGER IGF1 VS PDGFB TARGETS UP | 82 | 51 | All SZGR 2.0 genes in this pathway |
JIANG HYPOXIA NORMAL | 311 | 205 | All SZGR 2.0 genes in this pathway |
BANDRES RESPONSE TO CARMUSTIN WITHOUT MGMT 48HR DN | 32 | 25 | All SZGR 2.0 genes in this pathway |
GENTILE UV LOW DOSE DN | 67 | 46 | All SZGR 2.0 genes in this pathway |
ZHONG SECRETOME OF LUNG CANCER AND ENDOTHELIUM | 66 | 47 | All SZGR 2.0 genes in this pathway |
LEIN OLIGODENDROCYTE MARKERS | 74 | 53 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 TARGETS DN | 543 | 317 | All SZGR 2.0 genes in this pathway |
MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
DAIRKEE CANCER PRONE RESPONSE E2 | 28 | 21 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL CULTURED VS FRESH UP | 425 | 298 | All SZGR 2.0 genes in this pathway |
SWEET LUNG CANCER KRAS DN | 435 | 289 | All SZGR 2.0 genes in this pathway |
LIU VAV3 PROSTATE CARCINOGENESIS UP | 89 | 61 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 16 | 79 | 47 | All SZGR 2.0 genes in this pathway |
PASINI SUZ12 TARGETS DN | 315 | 215 | All SZGR 2.0 genes in this pathway |
WANG NFKB TARGETS | 25 | 15 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-142-5p | 148 | 154 | 1A | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-299-5p | 157 | 163 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
miR-30-5p | 105 | 112 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-495 | 102 | 108 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.