Gene Page: THBS3
Summary ?
GeneID | 7059 |
Symbol | THBS3 |
Synonyms | TSP3 |
Description | thrombospondin 3 |
Reference | MIM:188062|HGNC:HGNC:11787|Ensembl:ENSG00000169231|HPRD:01767|Vega:OTTHUMG00000035710 |
Gene type | protein-coding |
Map location | 1q21 |
Sherlock p-value | 0.003 |
Fetal beta | 0.229 |
eGene | Cerebellar Hemisphere Cerebellum |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
STIM1 | 0.87 | 0.91 |
PSAP | 0.85 | 0.86 |
CTSA | 0.85 | 0.86 |
ANXA7 | 0.84 | 0.85 |
TFE3 | 0.84 | 0.85 |
NPTN | 0.84 | 0.82 |
PRNP | 0.83 | 0.90 |
STAT6 | 0.83 | 0.82 |
ARHGEF4 | 0.83 | 0.85 |
SIRPA | 0.83 | 0.87 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RBMX2 | -0.57 | -0.57 |
BCL7C | -0.55 | -0.62 |
KIAA1949 | -0.54 | -0.36 |
TUBB2B | -0.52 | -0.42 |
EXOSC8 | -0.52 | -0.49 |
IGF2BP2 | -0.52 | -0.45 |
ZNF300 | -0.52 | -0.26 |
RPS8 | -0.51 | -0.54 |
CARHSP1 | -0.51 | -0.48 |
RPS19P3 | -0.51 | -0.60 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005509 | calcium ion binding | TAS | 8288588 | |
GO:0005515 | protein binding | IEA | - | |
GO:0005198 | structural molecule activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007160 | cell-matrix adhesion | TAS | 8468055 | |
GO:0007155 | cell adhesion | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | EXP | 6338048 | |
GO:0005576 | extracellular region | IEA | - | |
GO:0031093 | platelet alpha granule lumen | EXP | 6338048 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG TGF BETA SIGNALING PATHWAY | 86 | 64 | All SZGR 2.0 genes in this pathway |
KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
KEGG ECM RECEPTOR INTERACTION | 84 | 53 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY PDGF | 122 | 93 | All SZGR 2.0 genes in this pathway |
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
AUNG GASTRIC CANCER | 54 | 20 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 1Q21 AMPLICON | 38 | 18 | All SZGR 2.0 genes in this pathway |
NIKOLSKY MUTATED AND AMPLIFIED IN BREAST CANCER | 94 | 60 | All SZGR 2.0 genes in this pathway |
LEE CALORIE RESTRICTION NEOCORTEX UP | 83 | 66 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
MCDOWELL ACUTE LUNG INJURY DN | 48 | 33 | All SZGR 2.0 genes in this pathway |
ZHANG GATA6 TARGETS DN | 64 | 46 | All SZGR 2.0 genes in this pathway |
SARRIO EPITHELIAL MESENCHYMAL TRANSITION DN | 154 | 101 | All SZGR 2.0 genes in this pathway |
GRADE COLON VS RECTAL CANCER DN | 56 | 36 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS DN | 784 | 464 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
NABA ECM GLYCOPROTEINS | 196 | 99 | All SZGR 2.0 genes in this pathway |
NABA CORE MATRISOME | 275 | 148 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-183 | 227 | 233 | 1A | hsa-miR-183 | UAUGGCACUGGUAGAAUUCACUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.