Summary ?
GeneID7170
SymbolTPM3
SynonymsCAPM1|CFTD|HEL-189|HEL-S-82p|NEM1|OK/SW-cl.5|TM-5|TM3|TM30|TM30nm|TM5|TPMsk3|TRK|hscp30
Descriptiontropomyosin 3
ReferenceMIM:191030|HGNC:HGNC:12012|Ensembl:ENSG00000143549|HPRD:01840|Vega:OTTHUMG00000035853
Gene typeprotein-coding
Map location1q21.2
Sherlock p-value0.951
Fetal beta2.778
DMG1 (# studies)
eGeneMeta
SupportG2Cdb.humanPSD
G2Cdb.humanPSP
CompositeSet

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 1
GSMA_IGenome scan meta-analysisPsr: 0.0235 
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.00814 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg245460831154155925TPM32.81E-5-0.3390.018DMG:Wockner_2014


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003779actin bindingIEA-
GO:0003674molecular_functionND-
GO:0005515protein bindingIPI17353931 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006937regulation of muscle contractionNAS-
GO:0006928cell motionTAS16130169 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0043005neuron projectionIEAneuron, axon, neurite, dendrite (GO term level: 5)-
GO:0030426growth coneIEAaxon, dendrite (GO term level: 5)-
GO:0002102podosomeIEA-
GO:0005856cytoskeletonNAS3418707 
GO:0005856cytoskeletonTAS16130169 
GO:0005862muscle thin filament tropomyosinTAS3018581 
GO:0005737cytoplasmIEA-
GO:0032154cleavage furrowIEA-
GO:0031941filamentous actinIEA-
GO:0030863cortical cytoskeletonIEA-

Section IV. Protein-protein interaction annotation

InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ACTBPS1TP5BP1actin, beta-HPRD9108196 
C19orf50FLJ25480 | MGC2749 | MST096 | MSTP096chromosome 19 open reading frame 50Two-hybridBioGRID16189514 
CHUKIKBKA | IKK-alpha | IKK1 | IKKA | NFKBIKA | TCF16conserved helix-loop-helix ubiquitous kinase-HPRD14743216 
CNN1SMCC | Sm-Calpcalponin 1, basic, smooth muscle-HPRD2161834 |2455687 
EIF4A2BM-010 | DDX2B | EIF4A | EIF4Feukaryotic translation initiation factor 4A, isoform 2Affinity Capture-MSBioGRID17353931 
IKBKEIKK-i | IKKE | IKKI | KIAA0151 | MGC125294 | MGC125295 | MGC125297inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon-HPRD14743216 
MCCDKFZp762O1615 | FLJ38893 | FLJ46755 | MCC1mutated in colorectal cancersAffinity Capture-MSBioGRID17353931 
RIPK3RIP3receptor-interacting serine-threonine kinase 3-HPRD14743216 
S100A418A2 | 42A | CAPL | FSP1 | MTS1 | P9KA | PEL98S100 calcium binding protein A4-HPRD8120097 
TFPTFB1 | INO80F | amidaTCF3 (E2A) fusion partner (in childhood Leukemia)Two-hybridBioGRID16189514 
TPM3FLJ41118 | MGC14582 | MGC3261 | MGC72094 | NEM1 | OK/SW-cl.5 | TM-5 | TM3 | TM30 | TM30nm | TPMsk3 | TRK | hscp30tropomyosin 3-HPRD2161834 |2455687 
TPM3FLJ41118 | MGC14582 | MGC3261 | MGC72094 | NEM1 | OK/SW-cl.5 | TM-5 | TM3 | TM30 | TM30nm | TPMsk3 | TRK | hscp30tropomyosin 3Affinity Capture-WesternBioGRID7568216 


Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG CARDIAC MUSCLE CONTRACTION 8051All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER 328259All SZGR 2.0 genes in this pathway
KEGG THYROID CANCER 2926All SZGR 2.0 genes in this pathway
KEGG HYPERTROPHIC CARDIOMYOPATHY HCM 8565All SZGR 2.0 genes in this pathway
KEGG DILATED CARDIOMYOPATHY 9268All SZGR 2.0 genes in this pathway
REACTOME STRIATED MUSCLE CONTRACTION 2712All SZGR 2.0 genes in this pathway
REACTOME MUSCLE CONTRACTION 4824All SZGR 2.0 genes in this pathway
REACTOME SMOOTH MUSCLE CONTRACTION 2514All SZGR 2.0 genes in this pathway
ODONNELL TFRC TARGETS UP 456228All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION DN 234147All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND SERUM DEPRIVATION DN 8454All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 17811082All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN 770415All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER DN 185115All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW DN 165107All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH DN 180110All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA DN 181107All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 17 2512All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 24 147All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC 3525All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS 957597All SZGR 2.0 genes in this pathway
LOCKWOOD AMPLIFIED IN LUNG CANCER 214139All SZGR 2.0 genes in this pathway
RAHMAN TP53 TARGETS PHOSPHORYLATED 2118All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX 795478All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN 514330All SZGR 2.0 genes in this pathway
RICKMAN HEAD AND NECK CANCER F 5432All SZGR 2.0 genes in this pathway
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN 206136All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS 734436All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP 266171All SZGR 2.0 genes in this pathway
ULE SPLICING VIA NOVA2 4338All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP 487303All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR 681420All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS DN 314188All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN 911527All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN 1011592All SZGR 2.0 genes in this pathway
ZHONG SECRETOME OF LUNG CANCER AND ENDOTHELIUM 6647All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 528324All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS 245148All SZGR 2.0 genes in this pathway
GRADE COLON CANCER UP 871505All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS DN 210128All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP 323240All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C CLUSTER UP 3826All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA C D UP 13995All SZGR 2.0 genes in this pathway
CHANG CORE SERUM RESPONSE UP 212128All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK 1210725All SZGR 2.0 genes in this pathway
NGO MALIGNANT GLIOMA 1P LOH 1713All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA NEURAL 12985All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS DN 213127All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN 19721213All SZGR 2.0 genes in this pathway
IKEDA MIR1 TARGETS UP 5339All SZGR 2.0 genes in this pathway
STEINER ERYTHROCYTE MEMBRANE GENES 1510All SZGR 2.0 genes in this pathway
KRIEG KDM3A TARGETS NOT HYPOXIA 208107All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-433-5p410m8hsa-miR-433-5pUACGGUGAGCCUGUCAUUAUUC