Gene Page: CALCA
Summary ?
GeneID | 796 |
Symbol | CALCA |
Synonyms | CALC1|CGRP|CGRP-I|CGRP1|CT|KC|PCT |
Description | calcitonin related polypeptide alpha |
Reference | MIM:114130|HGNC:HGNC:1437|Ensembl:ENSG00000110680|HPRD:00238|Vega:OTTHUMG00000159731 |
Gene type | protein-coding |
Map location | 11p15.2 |
Pascal p-value | 0.706 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 4 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 4 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg26833169 | 11 | 14994045 | CALCA | 4.48E-5 | -0.381 | 0.021 | DMG:Wockner_2014 |
cg09188980 | 11 | 14993378 | CALCA | 1E-4 | -0.53 | 0.028 | DMG:Wockner_2014 |
cg25783352 | 11 | 14993509 | CALCA | 1.029E-4 | -0.449 | 0.028 | DMG:Wockner_2014 |
cg22863523 | 11 | 14995201 | CALCA | 3.306E-4 | 0.939 | 0.041 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
GOLIM4 | 0.81 | 0.83 |
COBLL1 | 0.78 | 0.79 |
TLN1 | 0.75 | 0.81 |
PTRF | 0.73 | 0.76 |
CGNL1 | 0.72 | 0.78 |
FYCO1 | 0.72 | 0.82 |
COL14A1 | 0.71 | 0.73 |
GIMAP8 | 0.71 | 0.74 |
MYH11 | 0.71 | 0.71 |
FAM129A | 0.70 | 0.73 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ZNF32 | -0.49 | -0.59 |
COMMD3 | -0.47 | -0.56 |
NDUFAF2 | -0.47 | -0.55 |
PFDN5 | -0.47 | -0.59 |
PHPT1 | -0.46 | -0.57 |
OXSM | -0.46 | -0.54 |
C11orf73 | -0.46 | -0.54 |
MRPS24 | -0.46 | -0.50 |
AC034193.4 | -0.46 | -0.50 |
DCTN3 | -0.46 | -0.49 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005179 | hormone activity | IEA | - | |
GO:0031716 | calcitonin receptor binding | IEA | - | |
GO:0031716 | calcitonin receptor binding | IPI | 8078488 |8940110 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007218 | neuropeptide signaling pathway | IEA | Neurotransmitter (GO term level: 8) | - |
GO:0001984 | vasodilation of artery during baroreceptor response to increased systemic arterial blood pressure | IEA | - | |
GO:0002027 | regulation of heart rate | IEA | - | |
GO:0001944 | vasculature development | IDA | 17267696 | |
GO:0001935 | endothelial cell proliferation | IDA | 17267696 | |
GO:0001976 | regulation of systemic arterial blood pressure by neurological process | IDA | 10642343 | |
GO:0007190 | activation of adenylate cyclase activity | IDA | 10822112 |16014619 | |
GO:0007267 | cell-cell signaling | TAS | 2408883 | |
GO:0009408 | response to heat | IEA | - | |
GO:0007631 | feeding behavior | IEA | - | |
GO:0007566 | embryo implantation | IDA | 17983652 | |
GO:0006954 | inflammatory response | IEA | - | |
GO:0007159 | leukocyte adhesion | IDA | 1326102 | |
GO:0016481 | negative regulation of transcription | IDA | 11014233 | |
GO:0050965 | detection of temperature stimulus involved in sensory perception of pain | IEA | - | |
GO:0032757 | positive regulation of interleukin-8 production | IDA | 16904178 | |
GO:0032730 | positive regulation of interleukin-1 alpha production | IDA | 16904178 | |
GO:0048265 | response to pain | IEA | - | |
GO:0030279 | negative regulation of ossification | IEA | - | |
GO:0031645 | negative regulation of neurological system process | IEA | - | |
GO:0032147 | activation of protein kinase activity | IDA | 17983652 | |
GO:0045779 | negative regulation of bone resorption | IDA | 10822112 |17241109 | |
GO:0045778 | positive regulation of ossification | IEA | - | |
GO:0045651 | positive regulation of macrophage differentiation | IDA | 10822112 | |
GO:0045762 | positive regulation of adenylate cyclase activity | IDA | 8078488 |11014233 | |
GO:0045909 | positive regulation of vasodilation | IDA | 3266556 | |
GO:0045671 | negative regulation of osteoclast differentiation | IDA | 10822112 | |
GO:0043542 | endothelial cell migration | IDA | 17267696 | |
GO:0045986 | negative regulation of smooth muscle contraction | IEA | - | |
GO:0045776 | negative regulation of blood pressure | IDA | 10642343 | |
GO:0051480 | cytosolic calcium ion homeostasis | IDA | 9685362 | |
GO:0051482 | elevation of cytosolic calcium ion concentration during G-protein signaling, coupled to IP3 second messenger (phospholipase C activating) | IDA | 8078488 |9685362 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0043025 | cell soma | IEA | axon, dendrite (GO term level: 4) | - |
GO:0043195 | terminal button | IEA | axon, Synap, Neurotransmitter (GO term level: 8) | - |
GO:0030424 | axon | IEA | neuron, axon, Neurotransmitter (GO term level: 6) | - |
GO:0005576 | extracellular region | IEA | - | |
GO:0005615 | extracellular space | IDA | 2408883 |18057382 | |
GO:0005622 | intracellular | IEA | - | |
GO:0005737 | cytoplasm | IDA | 17267696 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS | 88 | 58 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
REACTOME G ALPHA S SIGNALLING EVENTS | 121 | 82 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
REACTOME AMYLOIDS | 83 | 63 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
TANAKA METHYLATED IN ESOPHAGEAL CARCINOMA | 103 | 58 | All SZGR 2.0 genes in this pathway |
SCHLESINGER METHYLATED DE NOVO IN CANCER | 88 | 64 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR UP | 176 | 115 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 12HR DN | 57 | 45 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
KANG IMMORTALIZED BY TERT DN | 102 | 67 | All SZGR 2.0 genes in this pathway |
BRUNO HEMATOPOIESIS | 66 | 48 | All SZGR 2.0 genes in this pathway |
RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
NAKAMURA METASTASIS MODEL DN | 43 | 28 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 60HR UP | 293 | 203 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14 | 143 | 86 | All SZGR 2.0 genes in this pathway |
KOHOUTEK CCNT2 TARGETS | 58 | 35 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-488 | 247 | 253 | m8 | hsa-miR-488 | CCCAGAUAAUGGCACUCUCAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.