Summary ?
GeneID79646
SymbolPANK3
Synonyms-
Descriptionpantothenate kinase 3
ReferenceMIM:606161|HGNC:HGNC:19365|HPRD:07312|
Gene typeprotein-coding
Map location5q34
Pascal p-value0.034

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
GSMA_IIAGenome scan meta-analysis (All samples)Psr: 0.0276 

Section I. Genetics and epigenetics annotation


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005524ATP bindingIEA-
GO:0004594pantothenate kinase activityIEA-
GO:0016740transferase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0015937coenzyme A biosynthetic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG PANTOTHENATE AND COA BIOSYNTHESIS 169All SZGR 2.0 genes in this pathway
REACTOME VITAMIN B5 PANTOTHENATE METABOLISM 117All SZGR 2.0 genes in this pathway
REACTOME METABOLISM OF VITAMINS AND COFACTORS 5136All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS TURQUOISE UP 7950All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR UP 557331All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP 1278748All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN 17811082All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 5 6WK DN 13797All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL BREAST 6 7WK UP 197135All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN 514319All SZGR 2.0 genes in this pathway
GARCIA TARGETS OF FLI1 AND DAX1 DN 176104All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP 292168All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP 424268All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP 240152All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP 314201All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN 153120All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN 830547All SZGR 2.0 genes in this pathway
JI RESPONSE TO FSH DN 5843All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP 566371All SZGR 2.0 genes in this pathway
HOWLIN CITED1 TARGETS 1 UP 3525All SZGR 2.0 genes in this pathway
TING SILENCED BY DICER 3117All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR UP 294199All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN 882538All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D 882506All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND WITH H4K20ME1 MARK 14582All SZGR 2.0 genes in this pathway
VERNOCHET ADIPOGENESIS 1911All SZGR 2.0 genes in this pathway
PECE MAMMARY STEM CELL DN 14688All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1012852921A,m8hsa-miR-101UACAGUACUGUGAUAACUGAAG
miR-409-3p8198251Ahsa-miR-409-3pCGAAUGUUGCUCGGUGAACCCCU
miR-485-5p222228m8hsa-miR-485-5pAGAGGCUGGCCGUGAUGAAUUC
miR-5434724781Ahsa-miR-543AAACAUUCGCGGUGCACUUCU
miR-98894m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA