Gene Page: CAMK4
Summary ?
| GeneID | 814 |
| Symbol | CAMK4 |
| Synonyms | CaMK IV|CaMK-GR|IV|caMK |
| Description | calcium/calmodulin-dependent protein kinase IV |
| Reference | MIM:114080|HGNC:HGNC:1464|HPRD:07169| |
| Gene type | protein-coding |
| Map location | 5q21.3 |
| Pascal p-value | 0.197 |
| TADA p-value | 0.011 |
| Fetal beta | -0.54 |
| eGene | Cerebellar Hemisphere Cerebellum Myers' cis & trans |
| Support | INTRACELLULAR SIGNAL TRANSDUCTION SEROTONIN CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Xu_2012 | Whole Exome Sequencing analysis | De novo mutations of 4 genes were identified by exome sequencing of 795 samples in this study | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| CAMK4 | chr5 | 110818516 | C | T | NM_001744 | p.288R>W | missense | Schizophrenia | DNM:Xu_2012 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs16869851 | chr4 | 20690056 | CAMK4 | 814 | 0.15 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| SLC45A4 | 0.86 | 0.80 |
| KCNC1 | 0.85 | 0.81 |
| PIP4K2C | 0.85 | 0.84 |
| KIAA0513 | 0.84 | 0.84 |
| STAC2 | 0.84 | 0.66 |
| MPP1 | 0.84 | 0.72 |
| ANKH | 0.83 | 0.83 |
| NCKIPSD | 0.83 | 0.75 |
| KCNC3 | 0.83 | 0.74 |
| RNF157 | 0.82 | 0.79 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| IL32 | -0.42 | -0.44 |
| AF347015.21 | -0.41 | -0.37 |
| DBI | -0.41 | -0.49 |
| GNG11 | -0.40 | -0.45 |
| APOC1 | -0.39 | -0.40 |
| C1orf61 | -0.39 | -0.48 |
| C16orf74 | -0.39 | -0.40 |
| FAM159B | -0.39 | -0.55 |
| CLEC3B | -0.39 | -0.47 |
| GPR39 | -0.38 | -0.45 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005509 | calcium ion binding | IEA | - | |
| GO:0005516 | calmodulin binding | IEA | - | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0004683 | calmodulin-dependent protein kinase activity | IEA | - | |
| GO:0016740 | transferase activity | IEA | - | |
| GO:0016563 | transcription activator activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007270 | nerve-nerve synaptic transmission | IEA | neuron, Synap (GO term level: 7) | - |
| GO:0006468 | protein amino acid phosphorylation | TAS | 8089075 | |
| GO:0007165 | signal transduction | TAS | 8089075 | |
| GO:0006913 | nucleocytoplasmic transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG CALCIUM SIGNALING PATHWAY | 178 | 134 | All SZGR 2.0 genes in this pathway |
| KEGG LONG TERM POTENTIATION | 70 | 57 | All SZGR 2.0 genes in this pathway |
| KEGG NEUROTROPHIN SIGNALING PATHWAY | 126 | 103 | All SZGR 2.0 genes in this pathway |
| BIOCARTA CACAM PATHWAY | 16 | 11 | All SZGR 2.0 genes in this pathway |
| BIOCARTA NFAT PATHWAY | 56 | 45 | All SZGR 2.0 genes in this pathway |
| BIOCARTA PGC1A PATHWAY | 26 | 20 | All SZGR 2.0 genes in this pathway |
| BIOCARTA STATHMIN PATHWAY | 19 | 17 | All SZGR 2.0 genes in this pathway |
| PID HDAC CLASSII PATHWAY | 34 | 27 | All SZGR 2.0 genes in this pathway |
| PID NFAT 3PATHWAY | 54 | 47 | All SZGR 2.0 genes in this pathway |
| PID BETA CATENIN NUC PATHWAY | 80 | 60 | All SZGR 2.0 genes in this pathway |
| PID PI3K PLC TRK PATHWAY | 36 | 31 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
| REACTOME DAG AND IP3 SIGNALING | 32 | 25 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY ERBB2 | 101 | 78 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY EGFR IN CANCER | 109 | 80 | All SZGR 2.0 genes in this pathway |
| REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE | 137 | 105 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY FGFR IN DISEASE | 127 | 88 | All SZGR 2.0 genes in this pathway |
| REACTOME TRANSMISSION ACROSS CHEMICAL SYNAPSES | 186 | 155 | All SZGR 2.0 genes in this pathway |
| REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME OPIOID SIGNALLING | 78 | 56 | All SZGR 2.0 genes in this pathway |
| REACTOME CA DEPENDENT EVENTS | 30 | 23 | All SZGR 2.0 genes in this pathway |
| REACTOME NEUROTRANSMITTER RECEPTOR BINDING AND DOWNSTREAM TRANSMISSION IN THE POSTSYNAPTIC CELL | 137 | 110 | All SZGR 2.0 genes in this pathway |
| REACTOME PLC BETA MEDIATED EVENTS | 43 | 32 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY PDGF | 122 | 93 | All SZGR 2.0 genes in this pathway |
| REACTOME DOWNSTREAM SIGNAL TRANSDUCTION | 95 | 76 | All SZGR 2.0 genes in this pathway |
| REACTOME ACTIVATION OF NMDA RECEPTOR UPON GLUTAMATE BINDING AND POSTSYNAPTIC EVENTS | 37 | 32 | All SZGR 2.0 genes in this pathway |
| REACTOME POST NMDA RECEPTOR ACTIVATION EVENTS | 33 | 28 | All SZGR 2.0 genes in this pathway |
| REACTOME DOWNSTREAM SIGNALING OF ACTIVATED FGFR | 100 | 74 | All SZGR 2.0 genes in this pathway |
| REACTOME PHOSPHOLIPASE C MEDIATED CASCADE | 54 | 40 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY FGFR | 112 | 80 | All SZGR 2.0 genes in this pathway |
| JAATINEN HEMATOPOIETIC STEM CELL DN | 226 | 132 | All SZGR 2.0 genes in this pathway |
| GAUSSMANN MLL AF4 FUSION TARGETS A DN | 90 | 61 | All SZGR 2.0 genes in this pathway |
| DARWICHE SKIN TUMOR PROMOTER DN | 185 | 115 | All SZGR 2.0 genes in this pathway |
| DARWICHE PAPILLOMA RISK LOW UP | 162 | 104 | All SZGR 2.0 genes in this pathway |
| DARWICHE PAPILLOMA RISK HIGH UP | 147 | 101 | All SZGR 2.0 genes in this pathway |
| DARWICHE SQUAMOUS CELL CARCINOMA UP | 146 | 104 | All SZGR 2.0 genes in this pathway |
| KIM MYCN AMPLIFICATION TARGETS UP | 92 | 64 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR UP | 487 | 286 | All SZGR 2.0 genes in this pathway |
| GEORGES TARGETS OF MIR192 AND MIR215 | 893 | 528 | All SZGR 2.0 genes in this pathway |
| MATSUDA NATURAL KILLER DIFFERENTIATION | 475 | 313 | All SZGR 2.0 genes in this pathway |
| LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
| ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
| MATZUK SPERMATID DIFFERENTIATION | 37 | 26 | All SZGR 2.0 genes in this pathway |
| MATZUK SPERMATOZOA | 114 | 77 | All SZGR 2.0 genes in this pathway |
| BREDEMEYER RAG SIGNALING NOT VIA ATM DN | 57 | 34 | All SZGR 2.0 genes in this pathway |
| FIRESTEIN PROLIFERATION | 175 | 125 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| LEE RECENT THYMIC EMIGRANT | 227 | 128 | All SZGR 2.0 genes in this pathway |
| SERVITJA ISLET HNF1A TARGETS UP | 163 | 111 | All SZGR 2.0 genes in this pathway |
| ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL DN | 308 | 187 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-500 | 107 | 114 | 1A,m8 | hsa-miR-500 | AUGCACCUGGGCAAGGAUUCUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.