SZGR2

Summary ?

GeneID	8440
Symbol	NCK2
Synonyms	GRB4\|NCKbeta
Description	NCK adaptor protein 2
Reference	MIM:604930\|HGNC:HGNC:7665\|Ensembl:ENSG00000071051\|HPRD:05378\|Vega:OTTHUMG00000153116
Gene type	protein-coding
Map location	2q12
Pascal p-value	0.032
Fetal beta	0.824
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GSMA_I	Genome scan meta-analysis	Psr: 0.0004
GSMA_IIA	Genome scan meta-analysis (All samples)	Psr: 0.00755
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0995

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg20268893	2	106362547	NCK2	6.85E-5	0.764	0.024	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs12447283	chr16	65595638	NCK2	8440		0.19		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SLC12A5	0.97	0.90
EHD3	0.96	0.90
MAP1A	0.96	0.93
SCN2B	0.95	0.92
RAB11FIP5	0.95	0.82
IQSEC3	0.94	0.90
ZFYVE28	0.94	0.91
PTPRN	0.93	0.90
LYNX1	0.93	0.91
RPH3A	0.93	0.94

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
BCL7C	-0.58	-0.69
C9orf46	-0.55	-0.64
GTF3C6	-0.54	-0.57
TRAF4	-0.54	-0.63
RPL23A	-0.53	-0.66
TUBB2B	-0.52	-0.60
EXOSC8	-0.52	-0.56
FADS2	-0.52	-0.47
DYNLT1	-0.52	-0.69
KIAA1949	-0.52	-0.47

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		12110186
GO:0008093	cytoskeletal adaptor activity	NAS		12110186
GO:0030159	receptor signaling complex scaffold activity	NAS		12110186
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006417	regulation of translation	IEA		-
GO:0007176	regulation of epidermal growth factor receptor activity	TAS		9737977
GO:0007173	epidermal growth factor receptor signaling pathway	TAS		9737977
GO:0007172	signal complex assembly	NAS		12110186
GO:0007165	signal transduction	TAS		9737977
GO:0008285	negative regulation of cell proliferation	TAS		9737977
GO:0007015	actin filament organization	IEA		-
GO:0016477	cell migration	IEA		-
GO:0042110	T cell activation	NAS		12110186
GO:0042102	positive regulation of T cell proliferation	IMP		12110186
GO:0030838	positive regulation of actin filament polymerization	IMP		12110186
GO:0030032	lamellipodium biogenesis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0012506	vesicle membrane	IEA		-
GO:0005737	cytoplasm	NAS		12110186
GO:0005783	endoplasmic reticulum	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABI1	ABI-1 \| E3B1 \| NAP1BP \| SSH3BP \| SSH3BP1	abl-interactor 1	-	HPRD	11557983
ABI2	ABI-2 \| ABI2B \| AIP-1 \| AblBP3 \| SSH3BP2 \| argBPIA \| argBPIB	abl interactor 2	Two-hybrid	BioGRID	16189514
AXIN1	AXIN \| MGC52315	axin 1	-	HPRD	11557983
AXL	JTK11 \| UFO	AXL receptor tyrosine kinase	Axl interacts with an unspecified isoform of Nck2.	BIND	12470648
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	-	HPRD	10887126
CBLB	DKFZp686J10223 \| DKFZp779A0729 \| DKFZp779F1443 \| FLJ36865 \| FLJ41152 \| Nbla00127 \| RNF56	Cas-Br-M (murine) ecotropic retroviral transforming sequence b	Two-hybrid	BioGRID	16189514
CD3E	FLJ18683 \| T3E \| TCRE	CD3e molecule, epsilon (CD3-TCR complex)	-	HPRD,BioGRID	12110186
CPSF6	CFIM \| CFIM68 \| HPBRII-4 \| HPBRII-7	cleavage and polyadenylation specific factor 6, 68kDa	Two-hybrid	BioGRID	16189514
DNM1	DNM	dynamin 1	-	HPRD	11557983
DOCK1	DOCK180 \| ced5	dedicator of cytokinesis 1	-	HPRD,BioGRID	11240126
DOK1	MGC117395 \| MGC138860 \| P62DOK	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	-	HPRD,BioGRID	9737977
EEF1G	EF1G \| GIG35	eukaryotic translation elongation factor 1 gamma	Two-hybrid	BioGRID	16169070
EFNB1	CFND \| CFNS \| EFL3 \| EPLG2 \| Elk-L \| LERK2 \| MGC8782	ephrin-B1	-	HPRD	11557983
EFNB2	EPLG5 \| HTKL \| Htk-L \| LERK5 \| MGC126226 \| MGC126227 \| MGC126228	ephrin-B2	-	HPRD	12206665
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	Affinity Capture-Western Reconstituted Complex	BioGRID	9737977 \|10026169
EGFR	ERBB \| ERBB1 \| HER1 \| PIG61 \| mENA	epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)	-	HPRD	1333047 \|9737977
FGFR1	BFGFR \| CD331 \| CEK \| FGFBR \| FLG \| FLJ99988 \| FLT2 \| HBGFR \| KAL2 \| N-SAM	fibroblast growth factor receptor 1	An unspecified isoform of FGFR1 interacts with NCK2. This interaction was modeled on a demonstrated interaction between FGFR1 from an unspecified species and human NCK2.	BIND	15117958
FLJ12529	FLJ39024 \| MGC9315	pre-mRNA cleavage factor I, 59 kDa subunit	Two-hybrid	BioGRID	16189514
FXR2	FMR1L2	fragile X mental retardation, autosomal homolog 2	Two-hybrid	BioGRID	16189514
HNRNPK	CSBP \| FLJ41122 \| HNRPK \| TUNP	heterogeneous nuclear ribonucleoprotein K	-	HPRD	11557983
HNRNPK	CSBP \| FLJ41122 \| HNRPK \| TUNP	heterogeneous nuclear ribonucleoprotein K	Two-hybrid	BioGRID	16189514
ILK	DKFZp686F1765 \| P59	integrin-linked kinase	-	HPRD,BioGRID	10022929
KIAA1217	DKFZp761L0424 \| MGC31990 \| SKT	KIAA1217	Two-hybrid	BioGRID	16189514
LIMS1	PINCH \| PINCH1	LIM and senescent cell antigen-like domains 1	Nck-2 interacts with PINCH	BIND	9843575
LIMS1	PINCH \| PINCH1	LIM and senescent cell antigen-like domains 1	-	HPRD,BioGRID	9843575
NCKIPSD	AF3P21 \| DIP \| DIP1 \| MGC23891 \| ORF1 \| SPIN90 \| WASLBP \| WISH	NCK interacting protein with SH3 domain	Two-hybrid	BioGRID	16189514
NTRK2	GP145-TrkB \| TRKB	neurotrophic tyrosine kinase, receptor, type 2	-	HPRD,BioGRID	12074588
PAK1	MGC130000 \| MGC130001 \| PAKalpha	p21 protein (Cdc42/Rac)-activated kinase 1	-	HPRD,BioGRID	10026169 \|11557983
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	-	HPRD,BioGRID	11027258
PKN2	MGC150606 \| MGC71074 \| PAK2 \| PRK2 \| PRKCL2 \| PRO2042 \| Pak-2	protein kinase N2	-	HPRD,BioGRID	10026169
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	-	HPRD,BioGRID	11950595
SF3B4	MGC10828 \| SAP49 \| SF3b49	splicing factor 3b, subunit 4, 49kDa	Two-hybrid	BioGRID	16189514
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	-	HPRD,BioGRID	10026169
TRIP6	MGC10556 \| MGC10558 \| MGC29959 \| MGC3837 \| MGC4423 \| OIP1 \| ZRP-1	thyroid hormone receptor interactor 6	Two-hybrid	BioGRID	16189514
WBP11	DKFZp779M1063 \| NPWBP \| SIPP1	WW domain binding protein 11	Two-hybrid	BioGRID	16189514
WIPF2	WICH \| WIRE	WAS/WASL interacting protein family, member 2	-	HPRD,BioGRID	12213210

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ERBB SIGNALING PATHWAY	87	71	All SZGR 2.0 genes in this pathway
KEGG AXON GUIDANCE	129	103	All SZGR 2.0 genes in this pathway
KEGG T CELL RECEPTOR SIGNALING PATHWAY	108	89	All SZGR 2.0 genes in this pathway
KEGG PATHOGENIC ESCHERICHIA COLI INFECTION	59	36	All SZGR 2.0 genes in this pathway
PID INSULIN PATHWAY	45	32	All SZGR 2.0 genes in this pathway
PID MET PATHWAY	80	60	All SZGR 2.0 genes in this pathway
PID REELIN PATHWAY	29	29	All SZGR 2.0 genes in this pathway
PID ILK PATHWAY	45	32	All SZGR 2.0 genes in this pathway
PID IGF1 PATHWAY	30	23	All SZGR 2.0 genes in this pathway
PID ERBB1 RECEPTOR PROXIMAL PATHWAY	35	29	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PID NEPHRIN NEPH1 PATHWAY	31	24	All SZGR 2.0 genes in this pathway
PID VEGFR1 2 PATHWAY	69	57	All SZGR 2.0 genes in this pathway
PID EPHRINB REV PATHWAY	30	25	All SZGR 2.0 genes in this pathway
PID FAK PATHWAY	59	45	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME CELL CELL COMMUNICATION	120	77	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY PDGF	122	93	All SZGR 2.0 genes in this pathway
REACTOME DOWNSTREAM SIGNAL TRANSDUCTION	95	76	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME ACTIVATION OF RAC	14	11	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ROBO RECEPTOR	30	26	All SZGR 2.0 genes in this pathway
REACTOME NEPHRIN INTERACTIONS	20	15	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
BORCZUK MALIGNANT MESOTHELIOMA DN	104	59	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP	544	308	All SZGR 2.0 genes in this pathway
HAHTOLA MYCOSIS FUNGOIDES CD4 DN	116	71	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN	770	415	All SZGR 2.0 genes in this pathway
MARTORIATI MDM4 TARGETS FETAL LIVER DN	514	319	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR UP	487	286	All SZGR 2.0 genes in this pathway
SWEET KRAS TARGETS UP	84	51	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 DN	830	547	All SZGR 2.0 genes in this pathway
SU THYMUS	20	12	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE DN	373	196	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP	196	137	All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE DN	220	147	All SZGR 2.0 genes in this pathway
HANN RESISTANCE TO BCL2 INHIBITOR DN	48	31	All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN	940	425	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G12 UP	39	17	All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS PROLIFERATION UP	178	108	All SZGR 2.0 genes in this pathway
KAPOSI LIVER CANCER MET UP	18	11	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS UP	221	135	All SZGR 2.0 genes in this pathway
LI INDUCED T TO NATURAL KILLER DN	116	83	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN	321	200	All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF	367	231	All SZGR 2.0 genes in this pathway
DURAND STROMA S UP	297	194	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	1006	1012	m8	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-124/506	536	542	m8	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	536	542	m8	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-183	643	649	m8	hsa-miR-183	UAUGGCACUGGUAGAAUUCACUG
miR-186	971	977	1A	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-200bc/429	1085	1091	1A	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-25/32/92/363/367	555	561	1A	hsa-miR-25^brain	CAUUGCACUUGUCUCGGUCUGA
				hsa-miR-32	UAUUGCACAUUACUAAGUUGC
				hsa-miR-92	UAUUGCACUUGUCCCGGCCUG
				hsa-miR-367	AAUUGCACUUUAGCAAUGGUGA
				hsa-miR-92b^SZ	UAUUGCACUCGUCCCGGCCUC
miR-30-5p	884	890	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-339	866	872	1A	hsa-miR-339	UCCCUGUCCUCCAGGAGCUCA
miR-369-3p	1086	1092	m8	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-455	1003	1009	m8	hsa-miR-455	UAUGUGCCUUUGGACUACAUCG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: NCK2