SZGR2

Summary ?

GeneID	8518
Symbol	IKBKAP
Synonyms	DYS\|ELP1\|FD\|IKAP\|IKI3\|TOT1
Description	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein
Reference	MIM:603722\|HGNC:HGNC:5959\|Ensembl:ENSG00000070061\|HPRD:04763\|Vega:OTTHUMG00000020465
Gene type	protein-coding
Map location	9q31
Pascal p-value	0.045
Sherlock p-value	0.766
Fetal beta	0.532
eGene	Nucleus accumbens basal ganglia
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.1609

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004871	signal transducer activity	TAS		9751059
GO:0003677	DNA binding	IDA		11714725
GO:0005515	protein binding	IPI		10094049 \|14667819 \|15383276
GO:0008607	phosphorylase kinase regulator activity	IDA		11818576
GO:0016944	RNA polymerase II transcription elongation factor activity	IDA		11714725
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006357	regulation of transcription from RNA polymerase II promoter	IDA		11818576
GO:0006350	transcription	IEA		-
GO:0006461	protein complex assembly	TAS		9751059
GO:0006468	protein amino acid phosphorylation	TAS		9751059
GO:0006955	immune response	TAS		9751059
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005730	nucleolus	IDA		11714725
GO:0005737	cytoplasm	IDA		11714725
GO:0008023	transcription elongation factor complex	IDA		11714725
GO:0016591	DNA-directed RNA polymerase II, holoenzyme	IDA		11714725

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BAT3	BAG-6 \| BAG6 \| D6S52E \| G3	HLA-B associated transcript 3	Two-hybrid	BioGRID	16169070
C11orf79	FLJ20487	chromosome 11 open reading frame 79	Two-hybrid	BioGRID	16169070
CCT5	CCT-epsilon \| CCTE \| KIAA0098 \| TCP-1-epsilon	chaperonin containing TCP1, subunit 5 (epsilon)	Two-hybrid	BioGRID	16169070
CDKN2B	CDK4I \| INK4B \| MTS2 \| P15 \| TP15 \| p15INK4b	cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)	Two-hybrid	BioGRID	16169070
CHUK	IKBKA \| IKK-alpha \| IKK1 \| IKKA \| NFKBIKA \| TCF16	conserved helix-loop-helix ubiquitous kinase	IKAP interacts with IKK-alpha. This interaction was modeled on a demonstrated interaction between human IKAP and IKK-alpha from an unspecified species.	BIND	9751059
CHUK	IKBKA \| IKK-alpha \| IKK1 \| IKKA \| NFKBIKA \| TCF16	conserved helix-loop-helix ubiquitous kinase	-	HPRD,BioGRID	9751059
CSTF2	CstF-64	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa	Two-hybrid	BioGRID	16169070
ELP2	FLJ10879 \| SHINC-2 \| STATIP1 \| StIP	elongation protein 2 homolog (S. cerevisiae)	Co-purification	BioGRID	11714725
ELP3	FLJ10422 \| KAT9	elongation protein 3 homolog (S. cerevisiae)	-	HPRD	10936
ELP3	FLJ10422 \| KAT9	elongation protein 3 homolog (S. cerevisiae)	Affinity Capture-Western Co-purification	BioGRID	11714725
ELP4	C11orf19 \| FLJ20498 \| PAX6NEB \| PAXNEB \| dJ68P15A.1	elongation protein 4 homolog (S. cerevisiae)	Co-purification	BioGRID	11714725
IKBKB	FLJ40509 \| IKK-beta \| IKK2 \| IKKB \| MGC131801 \| NFKBIKB	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	IKAP interacts with IKK-beta.	BIND	9751059
IKBKB	FLJ40509 \| IKK-beta \| IKK2 \| IKKB \| MGC131801 \| NFKBIKB	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	-	HPRD,BioGRID	9751059
MAN2A2	MANA2X	mannosidase, alpha, class 2A, member 2	Two-hybrid	BioGRID	16169070
MAP3K14	FTDCR1B \| HS \| HSNIK \| NIK	mitogen-activated protein kinase kinase kinase 14	-	HPRD,BioGRID	9751059
MAP3K14	FTDCR1B \| HS \| HSNIK \| NIK	mitogen-activated protein kinase kinase kinase 14	IKAP interacts with NIK.	BIND	9751059
MAPK8	JNK \| JNK1 \| JNK1A2 \| JNK21B1/2 \| PRKM8 \| SAPK1	mitogen-activated protein kinase 8	-	HPRD,BioGRID	12058026
MRPL42	HSPC204 \| MRP-L31 \| MRPL31 \| MRPS32 \| PTD007 \| RPML31	mitochondrial ribosomal protein L42	Two-hybrid	BioGRID	16169070
NDUFB9	B22 \| DKFZp566O173 \| FLJ22885 \| LYRM3 \| UQOR22	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa	Two-hybrid	BioGRID	16169070
NFKBIA	IKBA \| MAD-3 \| NFKBI	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	Reconstituted Complex	BioGRID	9751059
NIPSNAP3A	DKFZp564D177 \| FLJ13953 \| HSPC299 \| MGC14553 \| NIPSNAP4 \| TASSC	nipsnap homolog 3A (C. elegans)	Two-hybrid	BioGRID	16169070
PLP2	A4 \| A4-LSB \| MGC126187	proteolipid protein 2 (colonic epithelium-enriched)	Two-hybrid	BioGRID	16169070
SNAPIN	SNAPAP	SNAP-associated protein	Two-hybrid	BioGRID	16169070
TAC3	NKB \| NKNB \| PRO1155 \| ZNEUROK1	tachykinin 3	Two-hybrid	BioGRID	16169070
TTR	HsT2651 \| PALB \| TBPA	transthyretin	Two-hybrid	BioGRID	16169070
TXNDC9	APACD	thioredoxin domain containing 9	Two-hybrid	BioGRID	16169070

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA CD40 PATHWAY	15	13	All SZGR 2.0 genes in this pathway
BIOCARTA TNFR2 PATHWAY	18	15	All SZGR 2.0 genes in this pathway
GARY CD5 TARGETS DN	431	263	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN	911	527	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN	1011	592	All SZGR 2.0 genes in this pathway
MONNIER POSTRADIATION TUMOR ESCAPE UP	393	244	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS	212	121	All SZGR 2.0 genes in this pathway
WORSCHECH TUMOR REJECTION DN	10	6	All SZGR 2.0 genes in this pathway
FIRESTEIN PROLIFERATION	175	125	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G1 UP	113	70	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA UP	207	143	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS DN	553	343	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	313	319	m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-494	299	306	1A,m8	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: IKBKAP