Gene Page

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BAT3	BAG-6 \| BAG6 \| D6S52E \| G3	HLA-B associated transcript 3	Two-hybrid	BioGRID	16169070
C11orf79	FLJ20487	chromosome 11 open reading frame 79	Two-hybrid	BioGRID	16169070
CCT5	CCT-epsilon \| CCTE \| KIAA0098 \| TCP-1-epsilon	chaperonin containing TCP1, subunit 5 (epsilon)	Two-hybrid	BioGRID	16169070
CDKN2B	CDK4I \| INK4B \| MTS2 \| P15 \| TP15 \| p15INK4b	cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)	Two-hybrid	BioGRID	16169070
CHUK	IKBKA \| IKK-alpha \| IKK1 \| IKKA \| NFKBIKA \| TCF16	conserved helix-loop-helix ubiquitous kinase	IKAP interacts with IKK-alpha. This interaction was modeled on a demonstrated interaction between human IKAP and IKK-alpha from an unspecified species.	BIND	9751059
CHUK	IKBKA \| IKK-alpha \| IKK1 \| IKKA \| NFKBIKA \| TCF16	conserved helix-loop-helix ubiquitous kinase	-	HPRD,BioGRID	9751059
CSTF2	CstF-64	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa	Two-hybrid	BioGRID	16169070
ELP2	FLJ10879 \| SHINC-2 \| STATIP1 \| StIP	elongation protein 2 homolog (S. cerevisiae)	Co-purification	BioGRID	11714725
ELP3	FLJ10422 \| KAT9	elongation protein 3 homolog (S. cerevisiae)	-	HPRD	10936
ELP3	FLJ10422 \| KAT9	elongation protein 3 homolog (S. cerevisiae)	Affinity Capture-Western Co-purification	BioGRID	11714725
ELP4	C11orf19 \| FLJ20498 \| PAX6NEB \| PAXNEB \| dJ68P15A.1	elongation protein 4 homolog (S. cerevisiae)	Co-purification	BioGRID	11714725
IKBKB	FLJ40509 \| IKK-beta \| IKK2 \| IKKB \| MGC131801 \| NFKBIKB	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	IKAP interacts with IKK-beta.	BIND	9751059
IKBKB	FLJ40509 \| IKK-beta \| IKK2 \| IKKB \| MGC131801 \| NFKBIKB		-	HPRD,BioGRID	9751059
MAN2A2	MANA2X	mannosidase, alpha, class 2A, member 2	Two-hybrid	BioGRID	16169070
MAP3K14	FTDCR1B \| HS \| HSNIK \| NIK	mitogen-activated protein kinase kinase kinase 14	-	HPRD,BioGRID	9751059
MAP3K14	FTDCR1B \| HS \| HSNIK \| NIK	mitogen-activated protein kinase kinase kinase 14	IKAP interacts with NIK.	BIND	9751059
MAPK8	JNK \| JNK1 \| JNK1A2 \| JNK21B1/2 \| PRKM8 \| SAPK1	mitogen-activated protein kinase 8	-	HPRD,BioGRID	12058026
MRPL42	HSPC204 \| MRP-L31 \| MRPL31 \| MRPS32 \| PTD007 \| RPML31	mitochondrial ribosomal protein L42	Two-hybrid	BioGRID	16169070
NDUFB9	B22 \| DKFZp566O173 \| FLJ22885 \| LYRM3 \| UQOR22	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa	Two-hybrid	BioGRID	16169070
NFKBIA	IKBA \| MAD-3 \| NFKBI	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	Reconstituted Complex	BioGRID	9751059
NIPSNAP3A	DKFZp564D177 \| FLJ13953 \| HSPC299 \| MGC14553 \| NIPSNAP4 \| TASSC	nipsnap homolog 3A (C. elegans)	Two-hybrid	BioGRID	16169070
PLP2	A4 \| A4-LSB \| MGC126187	proteolipid protein 2 (colonic epithelium-enriched)	Two-hybrid	BioGRID	16169070
SNAPIN	SNAPAP	SNAP-associated protein	Two-hybrid	BioGRID	16169070
TAC3	NKB \| NKNB \| PRO1155 \| ZNEUROK1	tachykinin 3	Two-hybrid	BioGRID	16169070
TTR	HsT2651 \| PALB \| TBPA	transthyretin	Two-hybrid	BioGRID	16169070
TXNDC9	APACD	thioredoxin domain containing 9	Two-hybrid	BioGRID	16169070

Pathway annotation

Pathway name	Pathway size	# SZGR genes in pathway	Info
BIOCARTA_CD40_PATHWAY	15	13	All SZGR genes in this pathway
BIOCARTA_TNFR2_PATHWAY	18	15	All SZGR genes in this pathway
GARY_CD5_TARGETS_DN	431	263	All SZGR genes in this pathway
DIAZ_CHRONIC_MEYLOGENOUS_LEUKEMIA_UP	1382	904	All SZGR genes in this pathway
ENK_UV_RESPONSE_KERATINOCYTE_DN	485	334	All SZGR genes in this pathway
SHEN_SMARCA2_TARGETS_UP	424	268	All SZGR genes in this pathway
KRIGE_RESPONSE_TO_TOSEDOSTAT_6HR_DN	911	527	All SZGR genes in this pathway
KRIGE_RESPONSE_TO_TOSEDOSTAT_24HR_DN	1011	592	All SZGR genes in this pathway
MONNIER_POSTRADIATION_TUMOR_ESCAPE_UP	393	244	All SZGR genes in this pathway
SANSOM_APC_TARGETS	212	121	All SZGR genes in this pathway
WORSCHECH_TUMOR_REJECTION_DN	10	6	All SZGR genes in this pathway
FIRESTEIN_PROLIFERATION	175	125	All SZGR genes in this pathway
BOYAULT_LIVER_CANCER_SUBCLASS_G1_UP	113	70	All SZGR genes in this pathway
YAGI_AML_WITH_11Q23_REARRANGED	351	238	All SZGR genes in this pathway
CAIRO_HEPATOBLASTOMA_UP	207	143	All SZGR genes in this pathway
PILON_KLF1_TARGETS_DN	1972	1213	All SZGR genes in this pathway
FEVR_CTNNB1_TARGETS_DN	553	343	All SZGR genes in this pathway

miRNA Targets ?

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	313	319	m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-494	299	306	1A,m8	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.