Gene Page: KMO
Summary ?
| GeneID | 8564 |
| Symbol | KMO |
| Synonyms | dJ317G22.1 |
| Description | kynurenine 3-monooxygenase (kynurenine 3-hydroxylase) |
| Reference | MIM:603538|HGNC:HGNC:6381|Ensembl:ENSG00000117009|HPRD:04642|Vega:OTTHUMG00000039635 |
| Gene type | protein-coding |
| Map location | 1q42-q44 |
| Fetal beta | -2.185 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DNM:Guipponi_2014 | Whole Exome Sequencing analysis | 49 DNMs were identified by comparing the exome of 53 individuals with sporadic SCZ and of their non-affected parents | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
| Expression | Meta-analysis of gene expression | P value: 1.721 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias,schizotypal | Click to show details |
Section I. Genetics and epigenetics annotation
DNM table
| Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
|---|---|---|---|---|---|---|---|---|---|---|---|
| KMO | G | T | NM_003679 | p.A461S | missense | 0.37 | 0 | Schizophrenia | DNM:Guipponi_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| KIAA1244 | 0.79 | 0.79 |
| ARID5B | 0.75 | 0.81 |
| FRMPD4 | 0.74 | 0.78 |
| SNX9 | 0.73 | 0.78 |
| DNAJC6 | 0.73 | 0.75 |
| ANKH | 0.72 | 0.79 |
| C18orf1 | 0.72 | 0.75 |
| ANKS1B | 0.72 | 0.75 |
| BACE1 | 0.72 | 0.74 |
| SECISBP2L | 0.71 | 0.69 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| C1orf61 | -0.45 | -0.52 |
| RAB34 | -0.43 | -0.43 |
| DCI | -0.42 | -0.44 |
| RFXANK | -0.42 | -0.47 |
| DBI | -0.41 | -0.41 |
| SERF2 | -0.41 | -0.45 |
| IMPA2 | -0.40 | -0.44 |
| GNG11 | -0.40 | -0.40 |
| PECI | -0.40 | -0.45 |
| C7orf55 | -0.40 | -0.42 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004497 | monooxygenase activity | IEA | - | |
| GO:0004502 | kynurenine 3-monooxygenase activity | EXP | 10672018 | |
| GO:0004502 | kynurenine 3-monooxygenase activity | TAS | 9237672 | |
| GO:0009055 | electron carrier activity | TAS | 9237672 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0019674 | NAD metabolic process | EXP | 14704851 | |
| GO:0055114 | oxidation reduction | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005829 | cytosol | EXP | 10672018 | |
| GO:0005739 | mitochondrion | IEA | - | |
| GO:0005741 | mitochondrial outer membrane | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG TRYPTOPHAN METABOLISM | 40 | 33 | All SZGR 2.0 genes in this pathway |
| REACTOME METABOLISM OF AMINO ACIDS AND DERIVATIVES | 200 | 136 | All SZGR 2.0 genes in this pathway |
| REACTOME TRYPTOPHAN CATABOLISM | 11 | 9 | All SZGR 2.0 genes in this pathway |
| GARY CD5 TARGETS DN | 431 | 263 | All SZGR 2.0 genes in this pathway |
| DOANE BREAST CANCER CLASSES UP | 72 | 38 | All SZGR 2.0 genes in this pathway |
| DOANE RESPONSE TO ANDROGEN DN | 241 | 146 | All SZGR 2.0 genes in this pathway |
| TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR UP | 85 | 54 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER APOCRINE VS LUMINAL | 326 | 213 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER APOCRINE VS BASAL | 330 | 217 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
| SHEN SMARCA2 TARGETS DN | 357 | 212 | All SZGR 2.0 genes in this pathway |
| LU IL4 SIGNALING | 94 | 56 | All SZGR 2.0 genes in this pathway |
| DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY E2F4 UNSTIMULATED | 728 | 415 | All SZGR 2.0 genes in this pathway |
| RIGGI EWING SARCOMA PROGENITOR UP | 430 | 288 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
| MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER ERBB2 UP | 147 | 83 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
| BRUECKNER TARGETS OF MIRLET7A3 UP | 111 | 69 | All SZGR 2.0 genes in this pathway |
| BOHN PRIMARY IMMUNODEFICIENCY SYNDROM DN | 40 | 31 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
| POOLA INVASIVE BREAST CANCER UP | 288 | 168 | All SZGR 2.0 genes in this pathway |
| CHEN LIVER METABOLISM QTL CIS | 93 | 40 | All SZGR 2.0 genes in this pathway |
| CHIANG LIVER CANCER SUBCLASS INTERFERON UP | 26 | 10 | All SZGR 2.0 genes in this pathway |
| HOSHIDA LIVER CANCER SUBCLASS S3 | 266 | 180 | All SZGR 2.0 genes in this pathway |
| CAIRO HEPATOBLASTOMA DN | 267 | 160 | All SZGR 2.0 genes in this pathway |
| OHGUCHI LIVER HNF4A TARGETS DN | 149 | 85 | All SZGR 2.0 genes in this pathway |
| MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP | 259 | 159 | All SZGR 2.0 genes in this pathway |
| PURBEY TARGETS OF CTBP1 NOT SATB1 UP | 344 | 215 | All SZGR 2.0 genes in this pathway |
| PEDERSEN METASTASIS BY ERBB2 ISOFORM 6 | 29 | 20 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-203.1 | 2449 | 2455 | 1A | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.