Gene Page: SNAP23
Summary ?
GeneID | 8773 |
Symbol | SNAP23 |
Synonyms | HsT17016|SNAP-23|SNAP23A|SNAP23B |
Description | synaptosome associated protein 23kDa |
Reference | MIM:602534|HGNC:HGNC:11131|Ensembl:ENSG00000092531|HPRD:03962|Vega:OTTHUMG00000130625 |
Gene type | protein-coding |
Map location | 15q14 |
Pascal p-value | 0.001 |
Sherlock p-value | 0.345 |
eGene | Myers' cis & trans |
Support | EXOCYTOSIS |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0308 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs16894557 | chr6 | 28999825 | SNAP23 | 8773 | 0.19 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ADD3 | 0.92 | 0.91 |
PMP2 | 0.90 | 0.90 |
CYBRD1 | 0.89 | 0.87 |
GRAMD3 | 0.88 | 0.83 |
ALDH6A1 | 0.88 | 0.88 |
SLC9A9 | 0.87 | 0.86 |
AHCYL1 | 0.87 | 0.87 |
SSFA2 | 0.87 | 0.89 |
SLC4A4 | 0.86 | 0.91 |
SSPN | 0.86 | 0.88 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
NR2C2AP | -0.52 | -0.55 |
AC011491.1 | -0.51 | -0.57 |
MED19 | -0.49 | -0.53 |
ZNF821 | -0.49 | -0.44 |
MPP3 | -0.49 | -0.41 |
TUBB | -0.49 | -0.41 |
BZW2 | -0.49 | -0.46 |
GMIP | -0.49 | -0.39 |
IGFBP2 | -0.49 | -0.52 |
MYCN | -0.48 | -0.37 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 16189514 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006944 | membrane fusion | TAS | 10839363 | |
GO:0006903 | vesicle targeting | TAS | 8663154 | |
GO:0006892 | post-Golgi vesicle-mediated transport | TAS | 9727496 | |
GO:0015031 | protein transport | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0019717 | synaptosome | IEA | Synap, Brain (GO term level: 7) | - |
GO:0045202 | synapse | IEA | neuron, Synap, Neurotransmitter, Glial (GO term level: 2) | - |
GO:0005792 | microsome | IEA | - | |
GO:0005634 | nucleus | IDA | 18029348 | |
GO:0005737 | cytoplasm | IDA | 18029348 | |
GO:0005886 | plasma membrane | TAS | 9727496 | |
GO:0030054 | cell junction | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ABI2 | ABI-2 | ABI2B | AIP-1 | AblBP3 | SSH3BP2 | argBPIA | argBPIB | abl interactor 2 | Two-hybrid | BioGRID | 16189514 |
ABI3 | NESH | SSH3BP3 | ABI family, member 3 | Two-hybrid | BioGRID | 16189514 |
CFTR | ABC35 | ABCC7 | CF | CFTR/MRP | MRP7 | TNR-CFTR | dJ760C5.1 | cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) | - | HPRD,BioGRID | 12209004 |
FXR2 | FMR1L2 | fragile X mental retardation, autosomal homolog 2 | Two-hybrid | BioGRID | 16189514 |
ITSN1 | ITSN | MGC134948 | MGC134949 | SH3D1A | SH3P17 | intersectin 1 (SH3 domain protein) | - | HPRD,BioGRID | 10373452 |
KIF5B | KINH | KNS | KNS1 | UKHC | kinesin family member 5B | Reconstituted Complex Two-hybrid | BioGRID | 12475239 |
NAPA | SNAPA | N-ethylmaleimide-sensitive factor attachment protein, alpha | Affinity Capture-Western Two-hybrid | BioGRID | 16189514 |
SCAMP1 | SCAMP | SCAMP37 | secretory carrier membrane protein 1 | - | HPRD,BioGRID | 12124380 |
SCAMP2 | - | secretory carrier membrane protein 2 | - | HPRD,BioGRID | 12124380 |
SCGN | CALBL | DJ501N12.8 | SECRET | SEGN | setagin | secretagogin, EF-hand calcium binding protein | Two-hybrid | BioGRID | 16189514 |
SNAPIN | SNAPAP | SNAP-associated protein | SNAP23 interacts with Snapin. | BIND | 15635093 |
SNAPIN | SNAPAP | SNAP-associated protein | - | HPRD,BioGRID | 12877659 |
SNTG1 | G1SYN | SYN4 | syntrophin, gamma 1 | Reconstituted Complex | BioGRID | 12877659 |
STX11 | FHL4 | HLH4 | HPLH4 | syntaxin 11 | - | HPRD,BioGRID | 10036234 |
STX12 | MGC51957 | STX13 | STX14 | syntaxin 12 | - | HPRD,BioGRID | 9507000 |
STX18 | DKFZp686O15149 | Ufe1 | syntaxin 18 | Affinity Capture-MS | BioGRID | 15029241 |
STX1A | HPC-1 | STX1 | p35-1 | syntaxin 1A (brain) | - | HPRD | 12209004|12651853 |
STX1A | HPC-1 | STX1 | p35-1 | syntaxin 1A (brain) | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 8663154 |9168999 |9852078 |12651853 |12828989 |
STX1B | STX1B1 | STX1B2 | syntaxin 1B | Reconstituted Complex | BioGRID | 12651853 |
STX2 | EPIM | EPM | MGC51014 | STX2A | STX2B | STX2C | syntaxin 2 | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 8663154 |9168999 |12651853 |12828989 |
STX3 | STX3A | syntaxin 3 | - | HPRD | 9701566 |
STX3 | STX3A | syntaxin 3 | - | HPRD,BioGRID | 12828989 |
STX4 | STX4A | p35-2 | syntaxin 4 | - | HPRD,BioGRID | 9168999 |
STX5 | SED5 | STX5A | syntaxin 5 | Reconstituted Complex | BioGRID | 12651853 |
STX6 | - | syntaxin 6 | - | HPRD,BioGRID | 11001914 |
STXBP2 | Hunc18b | MUNC18-2 | UNC18-2 | UNC18B | pp10122 | syntaxin binding protein 2 | - | HPRD | 12773094 |
STXBP3 | MUNC18-3 | MUNC18C | PSP | UNC-18C | syntaxin binding protein 3 | Affinity Capture-Western | BioGRID | 12773094 |
STXBP5 | FLJ30922 | LGL3 | LLGL3 | MGC141942 | MGC141968 | Nbla04300 | syntaxin binding protein 5 (tomosyn) | - | HPRD,BioGRID | 12832401 |
SYN2 | SYNII | SYNIIa | SYNIIb | synapsin II | Affinity Capture-Western | BioGRID | 10820264 |
TLK1 | KIAA0137 | PKU-beta | tousled-like kinase 1 | - | HPRD | 10588641 |
VAMP1 | DKFZp686H12131 | SYB1 | VAMP-1 | vesicle-associated membrane protein 1 (synaptobrevin 1) | - | HPRD | 8663154 |
VAMP2 | FLJ11460 | SYB2 | VAMP-2 | vesicle-associated membrane protein 2 (synaptobrevin 2) | SNAP23 interacts with VAMP2. | BIND | 15610015 |
VAMP2 | FLJ11460 | SYB2 | VAMP-2 | vesicle-associated membrane protein 2 (synaptobrevin 2) | - | HPRD,BioGRID | 10713150 |
VAMP3 | CEB | vesicle-associated membrane protein 3 (cellubrevin) | Affinity Capture-Western | BioGRID | 10820264 |12828989 |
VAMP3 | CEB | vesicle-associated membrane protein 3 (cellubrevin) | - | HPRD | 12130530 |
VAMP3 | CEB | vesicle-associated membrane protein 3 (cellubrevin) | SNAP23 interacts with VAMP3. | BIND | 15610015 |
VAMP7 | SYBL1 | TI-VAMP | VAMP-7 | vesicle-associated membrane protein 7 | SNAP23 interacts with VAMP7. | BIND | 15610015 |
VAMP7 | SYBL1 | TI-VAMP | VAMP-7 | vesicle-associated membrane protein 7 | - | HPRD,BioGRID | 9614185 |
VAMP8 | EDB | vesicle-associated membrane protein 8 (endobrevin) | Affinity Capture-Western | BioGRID | 10820264 |12828989 |
VAMP8 | EDB | vesicle-associated membrane protein 8 (endobrevin) | - | HPRD | 10820264 |12130530 |12828989 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG SNARE INTERACTIONS IN VESICULAR TRANSPORT | 38 | 25 | All SZGR 2.0 genes in this pathway |
REACTOME MEMBRANE TRAFFICKING | 129 | 74 | All SZGR 2.0 genes in this pathway |
REACTOME TRANS GOLGI NETWORK VESICLE BUDDING | 60 | 31 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 TARGETS UP | 457 | 269 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS UP | 238 | 144 | All SZGR 2.0 genes in this pathway |
SENESE HDAC2 TARGETS UP | 114 | 66 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS UP | 501 | 327 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 8HR UP | 164 | 122 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN | 206 | 136 | All SZGR 2.0 genes in this pathway |
PETRETTO CARDIAC HYPERTROPHY | 34 | 26 | All SZGR 2.0 genes in this pathway |
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
BRUNO HEMATOPOIESIS | 66 | 48 | All SZGR 2.0 genes in this pathway |
REN ALVEOLAR RHABDOMYOSARCOMA DN | 408 | 274 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
JI RESPONSE TO FSH DN | 58 | 43 | All SZGR 2.0 genes in this pathway |
MARIADASON REGULATED BY HISTONE ACETYLATION UP | 83 | 49 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
CHUNG BLISTER CYTOTOXICITY DN | 44 | 29 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS UP | 518 | 299 | All SZGR 2.0 genes in this pathway |
CROONQUIST NRAS VS STROMAL STIMULATION UP | 41 | 26 | All SZGR 2.0 genes in this pathway |
HIRSCH CELLULAR TRANSFORMATION SIGNATURE UP | 242 | 159 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE EARLY LATE | 317 | 190 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 1205 | 1211 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-141/200a | 1447 | 1453 | 1A | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-182 | 309 | 316 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-186 | 15 | 21 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-330 | 1277 | 1284 | 1A,m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
miR-9 | 312 | 318 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
miR-96 | 310 | 316 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.