Gene Page: CDK5R2
Summary ?
| GeneID | 8941 |
| Symbol | CDK5R2 |
| Synonyms | NCK5AI|P39|p39nck5ai |
| Description | cyclin-dependent kinase 5, regulatory subunit 2 (p39) |
| Reference | MIM:603764|HGNC:HGNC:1776|Ensembl:ENSG00000171450|HPRD:04790|Vega:OTTHUMG00000133083 |
| Gene type | protein-coding |
| Map location | 2q35 |
| Pascal p-value | 0.131 |
| Fetal beta | -1.785 |
| DMG | 1 (# studies) |
| Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00916 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01016 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg16673768 | 2 | 219828170 | CDK5R2 | 5.48E-9 | -0.009 | 3.02E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ANAPC1 | 0.89 | 0.88 |
| UGCG | 0.88 | 0.88 |
| ARMC8 | 0.88 | 0.84 |
| STAM | 0.88 | 0.83 |
| PSMD5 | 0.88 | 0.86 |
| LMBR1 | 0.87 | 0.88 |
| KIAA1012 | 0.87 | 0.85 |
| AKAP10 | 0.87 | 0.87 |
| KIAA1468 | 0.87 | 0.88 |
| TMEM184C | 0.87 | 0.84 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MT-CO2 | -0.75 | -0.64 |
| AF347015.21 | -0.75 | -0.64 |
| AF347015.8 | -0.73 | -0.64 |
| HIGD1B | -0.73 | -0.66 |
| AF347015.2 | -0.72 | -0.60 |
| AF347015.31 | -0.72 | -0.62 |
| MT-CYB | -0.71 | -0.60 |
| AC098691.2 | -0.70 | -0.69 |
| AF347015.18 | -0.70 | -0.64 |
| AF347015.33 | -0.70 | -0.59 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016534 | cyclin-dependent protein kinase 5 activator activity | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000079 | regulation of cyclin-dependent protein kinase activity | TAS | 7592934 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016533 | cyclin-dependent protein kinase 5 activator complex | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PID LIS1 PATHWAY | 28 | 22 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
| RIZKI TUMOR INVASIVENESS 3D UP | 210 | 124 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-133 | 61 | 67 | m8 | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
| hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
| miR-331 | 137 | 143 | 1A | hsa-miR-331brain | GCCCCUGGGCCUAUCCUAGAA |
| miR-96 | 1142 | 1148 | m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.