Gene Page: P4HA2
Summary ?
GeneID | 8974 |
Symbol | P4HA2 |
Synonyms | - |
Description | prolyl 4-hydroxylase subunit alpha 2 |
Reference | MIM:600608|HGNC:HGNC:8547|Ensembl:ENSG00000072682|HPRD:11862|Vega:OTTHUMG00000059647 |
Gene type | protein-coding |
Map location | 5q31 |
Pascal p-value | 0.399 |
Sherlock p-value | 1.018E-4 |
Fetal beta | -0.572 |
DMG | 1 (# studies) |
eGene | Putamen basal ganglia Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GSMA_I | Genome scan meta-analysis | Psr: 0.0032 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg09140281 | 5 | 131563492 | P4HA2 | 4.973E-4 | -0.366 | 0.047 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6689013 | chr1 | 186980817 | P4HA2 | 8974 | 0.09 | trans | ||
rs7607798 | chr2 | 102043108 | P4HA2 | 8974 | 0.1 | trans | ||
rs1879328 | chr3 | 46568156 | P4HA2 | 8974 | 0.18 | trans | ||
rs7706288 | chr5 | 141864248 | P4HA2 | 8974 | 0.12 | trans | ||
rs3899870 | chr13 | 97205717 | P4HA2 | 8974 | 0.04 | trans | ||
rs9300361 | chr13 | 97210272 | P4HA2 | 8974 | 0.05 | trans | ||
rs16965683 | chr15 | 38115683 | P4HA2 | 8974 | 1.326E-4 | trans | ||
rs17283561 | chrX | 33355912 | P4HA2 | 8974 | 0.17 | trans | ||
rs5975293 | chrX | 130948027 | P4HA2 | 8974 | 0.18 | trans | ||
rs201959459 | 5 | 130864001 | P4HA2 | ENSG00000072682.14 | 2.703E-6 | 0.04 | 767007 | gtex_brain_putamen_basal |
rs25884 | 5 | 131412238 | P4HA2 | ENSG00000072682.14 | 3.434E-6 | 0.04 | 218770 | gtex_brain_putamen_basal |
rs45236 | 5 | 131440620 | P4HA2 | ENSG00000072682.14 | 3.03E-6 | 0.04 | 190388 | gtex_brain_putamen_basal |
rs269900 | 5 | 131482244 | P4HA2 | ENSG00000072682.14 | 3.03E-6 | 0.04 | 148764 | gtex_brain_putamen_basal |
rs2550973 | 5 | 131511141 | P4HA2 | ENSG00000072682.14 | 3.001E-6 | 0.04 | 119867 | gtex_brain_putamen_basal |
rs201381512 | 5 | 131511399 | P4HA2 | ENSG00000072682.14 | 2.009E-6 | 0.04 | 119609 | gtex_brain_putamen_basal |
rs152056 | 5 | 131517482 | P4HA2 | ENSG00000072682.14 | 2.662E-6 | 0.04 | 113526 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AGGF1 | 0.93 | 0.93 |
RAB6A | 0.92 | 0.92 |
ARMCX3 | 0.92 | 0.92 |
YWHAB | 0.91 | 0.89 |
BTRC | 0.91 | 0.90 |
C5orf22 | 0.90 | 0.90 |
SERINC1 | 0.90 | 0.90 |
CLTC | 0.90 | 0.90 |
VPS41 | 0.90 | 0.90 |
UCHL5 | 0.90 | 0.89 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FXYD1 | -0.63 | -0.58 |
EIF4EBP3 | -0.63 | -0.66 |
MT-CO2 | -0.62 | -0.58 |
AF347015.21 | -0.62 | -0.53 |
HIGD1B | -0.62 | -0.59 |
AF347015.31 | -0.61 | -0.59 |
ENHO | -0.61 | -0.67 |
AF347015.2 | -0.61 | -0.56 |
TLCD1 | -0.60 | -0.57 |
PLA2G5 | -0.59 | -0.56 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005506 | iron ion binding | IEA | - | |
GO:0005515 | protein binding | IPI | 14667819 | |
GO:0004656 | procollagen-proline 4-dioxygenase activity | TAS | 9211872 | |
GO:0016706 | oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors | IEA | - | |
GO:0016702 | oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen | IEA | - | |
GO:0009055 | electron carrier activity | TAS | 9211872 | |
GO:0016491 | oxidoreductase activity | IEA | - | |
GO:0031418 | L-ascorbic acid binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0019538 | protein metabolic process | IEA | - | |
GO:0055114 | oxidation reduction | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005788 | endoplasmic reticulum lumen | IEA | - | |
GO:0005783 | endoplasmic reticulum | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ARGININE AND PROLINE METABOLISM | 54 | 39 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL DN | 275 | 168 | All SZGR 2.0 genes in this pathway |
UDAYAKUMAR MED1 TARGETS DN | 240 | 171 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS 12HR UP | 162 | 116 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA UP | 171 | 112 | All SZGR 2.0 genes in this pathway |
ELVIDGE HYPOXIA BY DMOG UP | 130 | 85 | All SZGR 2.0 genes in this pathway |
ELVIDGE HIF1A TARGETS DN | 91 | 58 | All SZGR 2.0 genes in this pathway |
ELVIDGE HIF1A AND HIF2A TARGETS DN | 104 | 72 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP | 633 | 376 | All SZGR 2.0 genes in this pathway |
PROVENZANI METASTASIS DN | 136 | 94 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
CHEBOTAEV GR TARGETS UP | 77 | 62 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION DN | 234 | 147 | All SZGR 2.0 genes in this pathway |
CONCANNON APOPTOSIS BY EPOXOMICIN UP | 239 | 157 | All SZGR 2.0 genes in this pathway |
MISSIAGLIA REGULATED BY METHYLATION UP | 126 | 78 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER UP | 227 | 137 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN | 382 | 224 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR UP | 176 | 115 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
SWEET KRAS TARGETS UP | 84 | 51 | All SZGR 2.0 genes in this pathway |
MANALO HYPOXIA UP | 207 | 145 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
KANG IMMORTALIZED BY TERT UP | 89 | 61 | All SZGR 2.0 genes in this pathway |
MENSE HYPOXIA UP | 98 | 71 | All SZGR 2.0 genes in this pathway |
TRAYNOR RETT SYNDROM DN | 19 | 14 | All SZGR 2.0 genes in this pathway |
YAMAZAKI TCEB3 TARGETS UP | 175 | 116 | All SZGR 2.0 genes in this pathway |
LEONARD HYPOXIA | 47 | 35 | All SZGR 2.0 genes in this pathway |
SEMENZA HIF1 TARGETS | 36 | 32 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 | 307 | 185 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER UP | 973 | 570 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE UP | 863 | 514 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
PODAR RESPONSE TO ADAPHOSTIN UP | 147 | 98 | All SZGR 2.0 genes in this pathway |
QI PLASMACYTOMA DN | 100 | 63 | All SZGR 2.0 genes in this pathway |
WINTER HYPOXIA METAGENE | 242 | 168 | All SZGR 2.0 genes in this pathway |
MOOTHA PGC | 420 | 269 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C D DN | 252 | 155 | All SZGR 2.0 genes in this pathway |
TOOKER GEMCITABINE RESISTANCE DN | 122 | 84 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 8 | 49 | 36 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO GONADOTROPHINS UP | 91 | 59 | All SZGR 2.0 genes in this pathway |
SASSON RESPONSE TO FORSKOLIN UP | 90 | 58 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA MESENCHYMAL | 216 | 130 | All SZGR 2.0 genes in this pathway |
QI HYPOXIA | 140 | 96 | All SZGR 2.0 genes in this pathway |
CHYLA CBFA2T3 TARGETS DN | 242 | 146 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS UP | 217 | 131 | All SZGR 2.0 genes in this pathway |
WIERENGA STAT5A TARGETS GROUP1 | 136 | 76 | All SZGR 2.0 genes in this pathway |
WIEDERSCHAIN TARGETS OF BMI1 AND PCGF2 | 57 | 39 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS DN | 882 | 538 | All SZGR 2.0 genes in this pathway |
FARDIN HYPOXIA 11 | 32 | 29 | All SZGR 2.0 genes in this pathway |
PEDERSEN METASTASIS BY ERBB2 ISOFORM 7 | 403 | 240 | All SZGR 2.0 genes in this pathway |
KRIEG HYPOXIA NOT VIA KDM3A | 770 | 480 | All SZGR 2.0 genes in this pathway |
PHONG TNF RESPONSE NOT VIA P38 | 337 | 236 | All SZGR 2.0 genes in this pathway |
NABA ECM REGULATORS | 238 | 125 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 266 | 272 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-124/506 | 257 | 263 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-129-5p | 367 | 373 | 1A | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-30-5p | 320 | 327 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-9 | 302 | 308 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.