SZGR2

Summary ?

GeneID	9368
Symbol	SLC9A3R1
Synonyms	EBP50\|NHERF\|NHERF-1\|NHERF1\|NPHLOP2
Description	SLC9A3 regulator 1
Reference	MIM:604990\|HGNC:HGNC:11075\|Ensembl:ENSG00000109062\|HPRD:05406\|Vega:OTTHUMG00000178863
Gene type	protein-coding
Map location	17q25.1
Pascal p-value	0.991
Sherlock p-value	0.868
Fetal beta	-1.397
DMG	1 (# studies)
eGene	Cerebellar Hemisphere Cerebellum Myers' cis & trans Meta
Support	ION BALANCE CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0231

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
SLC9A3R1	chr17	72758193	A	G	NM_004252	p.162S>G	missense			Schizophrenia	DNM:Fromer_2014

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg02976539	17	72757302	SLC9A3R1	2.465E-4	-0.41	0.037	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs2384957	chr17	72784629	SLC9A3R1	9368	0	cis
rs13397687	chr2	123655344	SLC9A3R1	9368	0.07	trans
rs13414989	chr2	204991337	SLC9A3R1	9368	0.14	trans
rs9313483	chr5	169448229	SLC9A3R1	9368	0.07	trans
rs9313484	chr5	169448319	SLC9A3R1	9368	0	trans
rs794099	chr6	164690612	SLC9A3R1	9368	0.13	trans
rs12545427	chr8	74954879	SLC9A3R1	9368	0.07	trans
rs6472816	chr8	74961543	SLC9A3R1	9368	0.16	trans
rs11216730	chr11	117918701	SLC9A3R1	9368	0.15	trans
rs17504394	chr13	30646519	SLC9A3R1	9368	0.15	trans
rs2384957	chr17	72784629	SLC9A3R1	9368	0.12	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
GYG2	0.69	0.65
AC063977.1	0.66	0.72
DNER	0.63	0.71
C15orf39	0.63	0.62
ORAI2	0.63	0.76
RADIL	0.63	0.63
MAP2K3	0.60	0.66
LRRN2	0.60	0.72
DCLK2	0.60	0.62
CHST2	0.60	0.70

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.35	-0.43
AF347015.21	-0.35	-0.45
MT-CO2	-0.34	-0.42
AF347015.8	-0.34	-0.41
AF347015.2	-0.34	-0.41
AF347015.27	-0.33	-0.39
AF347015.33	-0.33	-0.38
MT-CYB	-0.32	-0.39
AF347015.15	-0.31	-0.37
MT-ATP8	-0.31	-0.41

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		11285285 \|12471024
GO:0030165	PDZ domain binding	IPI		16236806
GO:0031698	beta-2 adrenergic receptor binding	IPI		9560162
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006461	protein complex assembly	TAS		9430655
GO:0016055	Wnt receptor signaling pathway	IEA		-
GO:0030643	cellular phosphate ion homeostasis	IEA		-
GO:0032415	regulation of sodium:hydrogen antiporter activity	NAS		9560162
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0042995	cell projection	IEA	axon (GO term level: 4)	-
GO:0012505	endomembrane system	IEA		-
GO:0016020	membrane	IEA		-
GO:0015629	actin cytoskeleton	TAS		9430655
GO:0016324	apical plasma membrane	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABCC2	ABC30 \| CMOAT \| DJS \| KIAA1010 \| MRP2 \| cMRP	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	-	HPRD,BioGRID	12615054
ADRB2	ADRB2R \| ADRBR \| B2AR \| BAR \| BETA2AR	adrenergic, beta-2-, receptor, surface	-	HPRD,BioGRID	9560162 \|9671706
ADRB2	ADRB2R \| ADRBR \| B2AR \| BAR \| BETA2AR	adrenergic, beta-2-, receptor, surface	PDZ domain of NHERF binds to the C-terminus of B2AR.	BIND	9560162 \|9671706 \|12621035
AKAP10	D-AKAP2 \| MGC9414 \| PRKA10	A kinase (PRKA) anchor protein 10	-	HPRD	14531806
ATP6V1E1	ATP6E \| ATP6E2 \| ATP6V1E \| P31 \| Vma4	ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1	-	HPRD	10748165
CFTR	ABC35 \| ABCC7 \| CF \| CFTR/MRP \| MRP7 \| TNR-CFTR \| dJ760C5.1	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	First PDZ domain of EBP50 binds to the C-terminus of CFTR.	BIND	9671706 \|9677412 \|10852925 \|12621035
CFTR	ABC35 \| ABCC7 \| CF \| CFTR/MRP \| MRP7 \| TNR-CFTR \| dJ760C5.1	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	-	HPRD	9613608 \|9677412 \|10852925
CFTR	ABC35 \| ABCC7 \| CF \| CFTR/MRP \| MRP7 \| TNR-CFTR \| dJ760C5.1	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	Affinity Capture-Western in vitro in vivo Reconstituted Complex	BioGRID	9613608 \|9671706 \|9677412 \|10852925 \|12471024 \|12615054
CLCN3	CLC3 \| ClC-3	chloride channel 3	-	HPRD,BioGRID	12471024
CNGA2	CNCA \| CNCA1 \| CNG2 \| FLJ46312 \| OCNC1 \| OCNCALPHA \| OCNCa	cyclic nucleotide gated channel alpha 2	-	HPRD	14604981
CTNNB1	CTNNB \| DKFZp686D02253 \| FLJ25606 \| FLJ37923	catenin (cadherin-associated protein), beta 1, 88kDa	-	HPRD,BioGRID	12830000
EZR	CVIL \| CVL \| DKFZp762H157 \| FLJ26216 \| MGC1584 \| VIL2	ezrin	-	HPRD,BioGRID	9314537
GNAQ	G-ALPHA-q \| GAQ	guanine nucleotide binding protein (G protein), q polypeptide	-	HPRD,BioGRID	12193606
GNB2L1	Gnb2-rs1 \| H12.3 \| HLC-7 \| PIG21 \| RACK1	guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1	Affinity Capture-Western	BioGRID	11956211
KCNJ1	KIR1.1 \| ROMK \| ROMK1	potassium inwardly-rectifying channel, subfamily J, member 1	-	HPRD,BioGRID	14604981
KCNJ1	KIR1.1 \| ROMK \| ROMK1	potassium inwardly-rectifying channel, subfamily J, member 1	An unspecified isoform of ROMK interacts with NHERF-1. This interaction was modeled on a demonstrated interaction between Rat ROMK2 and Human NHERF-1.	BIND	14604981
LHCGR	FLJ41504 \| LCGR \| LGR2 \| LH/CG-R \| LH/CGR \| LHR \| LHRHR \| LSH-R	luteinizing hormone/choriogonadotropin receptor	hLHR interacts with EBP50.	BIND	14507927
MSN	-	moesin	moesin interacts with hNHE-RF.	BIND	9430655
MSN	-	moesin	-	HPRD,BioGRID	9430655
NF2	ACN \| BANF \| SCH	neurofibromin 2 (merlin)	-	HPRD,BioGRID	9430655
NF2	ACN \| BANF \| SCH	neurofibromin 2 (merlin)	Merlin interacts with hNHE-RF	BIND	9430655
NOS2	HEP-NOS \| INOS \| NOS \| NOS2A	nitric oxide synthase 2, inducible	-	HPRD,BioGRID	12080081
OPRK1	KOR \| OPRK	opioid receptor, kappa 1	-	HPRD,BioGRID	12004055
OPRK1	KOR \| OPRK	opioid receptor, kappa 1	-	HPRD	15070904
P2RY1	P2Y1	purinergic receptor P2Y, G-protein coupled, 1	NHERF interacts with P2Y1R.	BIND	9671706
P2RY1	P2Y1	purinergic receptor P2Y, G-protein coupled, 1	-	HPRD,BioGRID	9671706
PAG1	CBP \| FLJ37858 \| MGC138364 \| PAG	phosphoprotein associated with glycosphingolipid microdomains 1	-	HPRD,BioGRID	11684085
PDGFRA	CD140A \| MGC74795 \| PDGFR2 \| Rhe-PDGFRA	platelet-derived growth factor receptor, alpha polypeptide	-	HPRD,BioGRID	11046132 \|11882663
PDGFRB	CD140B \| JTK12 \| PDGF-R-beta \| PDGFR \| PDGFR1	platelet-derived growth factor receptor, beta polypeptide	-	HPRD,BioGRID	11046132
PDZK1	CAP70 \| CLAMP \| NHERF3 \| PDZD1	PDZ domain containing 1	Reconstituted Complex Two-hybrid	BioGRID	14531806
PIK3CA	MGC142161 \| MGC142163 \| PI3K \| p110-alpha	phosphoinositide-3-kinase, catalytic, alpha polypeptide	Reconstituted Complex	BioGRID	12954600
PLCB1	FLJ45792 \| PI-PLC \| PLC-154 \| PLC-I \| PLC154	phospholipase C, beta 1 (phosphoinositide-specific)	-	HPRD,BioGRID	10980202
PLCB2	FLJ38135	phospholipase C, beta 2	-	HPRD	10980202
PTH1R	MGC138426 \| MGC138452 \| PTHR \| PTHR1	parathyroid hormone 1 receptor	-	HPRD,BioGRID	12075354
RDX	DFNB24	radixin	Radixin interacts with hNHE-RF. This interaction was modeled on a demonstrated interaction between chicken radixin and human hNHE-RF.	BIND	9430655
RDX	DFNB24	radixin	-	HPRD	9430655\|12499563
SLC4A8	DKFZp761B2318 \| FLJ46462 \| NBC3	solute carrier family 4, sodium bicarbonate cotransporter, member 8	-	HPRD,BioGRID	12444018
SLC9A3	MGC126718 \| MGC126720 \| NHE3	solute carrier family 9 (sodium/hydrogen exchanger), member 3	-	HPRD,BioGRID	14580213
SLC9A3R1	EBP50 \| NHERF \| NHERF1 \| NPHLOP2	solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1	Far Western Reconstituted Complex	BioGRID	11046132 \|15070904
TBC1D10A	EPI64 \| TBC1D10 \| dJ130H16.1 \| dJ130H16.2	TBC1 domain family, member 10A	-	HPRD,BioGRID	11285285
TRPC5	TRP5	transient receptor potential cation channel, subfamily C, member 5	-	HPRD	10980202
YAP1	YAP \| YAP2 \| YAP65 \| YKI	Yes-associated protein 1, 65kDa	-	HPRD,BioGRID	10562288
YES1	HsT441 \| P61-YES \| Yes \| c-yes	v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1	Reconstituted Complex	BioGRID	10562288

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA CFTR PATHWAY	12	11	All SZGR 2.0 genes in this pathway
WNT SIGNALING	89	71	All SZGR 2.0 genes in this pathway
PID TXA2PATHWAY	57	43	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN	526	357	All SZGR 2.0 genes in this pathway
ZHONG RESPONSE TO AZACITIDINE AND TSA UP	183	119	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL UP	380	215	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP	450	256	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN	126	86	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 2 DN	77	46	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 DN	162	116	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN	378	231	All SZGR 2.0 genes in this pathway
WANG ESOPHAGUS CANCER VS NORMAL DN	101	66	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS DN	62	44	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL	330	217	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE UP	134	93	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC VS DUCTAL DN	114	58	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 UP	209	139	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 AND HIF1A DN	103	71	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN	206	136	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON	335	181	All SZGR 2.0 genes in this pathway
UEDA PERIFERAL CLOCK	169	111	All SZGR 2.0 genes in this pathway
STOSSI RESPONSE TO ESTRADIOL	50	35	All SZGR 2.0 genes in this pathway
LEI MYB TARGETS	318	215	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR UP	225	139	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN	287	208	All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS UP	113	71	All SZGR 2.0 genes in this pathway
BILD E2F3 ONCOGENIC SIGNATURE	246	153	All SZGR 2.0 genes in this pathway
RIGGINS TAMOXIFEN RESISTANCE UP	66	44	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B UP	172	109	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN	546	362	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN	342	220	All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS DN	210	128	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 UP	167	99	All SZGR 2.0 genes in this pathway
LEE DIFFERENTIATING T LYMPHOCYTE	200	115	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
COULOUARN TEMPORAL TGFB1 SIGNATURE DN	138	99	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
MARSON FOXP3 TARGETS UP	66	43	All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS DN	207	139	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 DN	374	217	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR UP	229	149	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR UP	324	193	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 UP	211	131	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 UP	281	183	All SZGR 2.0 genes in this pathway
VANDESLUIS COMMD1 TARGETS GROUP 3 UP	89	50	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL DN	428	246	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-339	404	410	m8	hsa-miR-339	UCCCUGUCCUCCAGGAGCUCA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SLC9A3R1