SZGR2

Summary ?

GeneID	94031
Symbol	HTRA3
Synonyms	Prsp\|Tasp
Description	HtrA serine peptidase 3
Reference	MIM:608785\|HGNC:HGNC:30406\|Ensembl:ENSG00000170801\|HPRD:08821\|Vega:OTTHUMG00000090561
Gene type	protein-coding
Map location	4p16.1
Pascal p-value	0.883
Fetal beta	-1.556
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg02577436	4	8271369	HTRA3	3.88E-5	-0.323	0.02	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs11265452	chr1	160594237	HTRA3	94031		0.15		trans
rs17093190	chr20	34459279	HTRA3	94031		0.09		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
FBXO41	0.92	0.91
SHANK1	0.91	0.91
IQSEC2	0.91	0.92
GRIN1	0.90	0.94
PIP5K1C	0.90	0.89
PITPNM2	0.90	0.93
PITPNM3	0.90	0.91
CBX6	0.90	0.87
SYN1	0.90	0.92
ZDHHC14	0.90	0.89

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
RAB13	-0.49	-0.57
C21orf57	-0.47	-0.44
C9orf46	-0.46	-0.42
MYL12A	-0.46	-0.52
RPS20	-0.44	-0.47
PECI	-0.44	-0.45
GTF3C6	-0.43	-0.39
GNG11	-0.42	-0.43
RPS6	-0.42	-0.40
ANP32B	-0.42	-0.46

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004252	serine-type endopeptidase activity	IEA	glutamate (GO term level: 7)	-
GO:0005515	protein binding	IEA		-
GO:0005520	insulin-like growth factor binding	IEA		-
GO:0008233	peptidase activity	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001558	regulation of cell growth	IEA		-
GO:0006508	proteolysis	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR DN	41	29	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP	544	308	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN	378	231	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2B	392	251	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER HIGH RECURRENCE	49	31	All SZGR 2.0 genes in this pathway
LIEN BREAST CARCINOMA METAPLASTIC	35	25	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
ROZANOV MMP14 TARGETS UP	266	171	All SZGR 2.0 genes in this pathway
TSENG IRS1 TARGETS DN	135	88	All SZGR 2.0 genes in this pathway
GRADE COLON VS RECTAL CANCER UP	38	21	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP	395	249	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3 UNMETHYLATED	536	296	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME2 AND H3K27ME3	59	35	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 6	75	48	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
SERVITJA LIVER HNF1A TARGETS UP	135	96	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP	279	155	All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN	418	245	All SZGR 2.0 genes in this pathway
DURAND STROMA S UP	297	194	All SZGR 2.0 genes in this pathway
NABA ECM REGULATORS	238	125	All SZGR 2.0 genes in this pathway
NABA MATRISOME ASSOCIATED	753	411	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	932	938	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-101	932	938	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-144	917	923	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-144	917	923	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-218	956	962	m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-24	748	754	m8	hsa-miR-24^SZ	UGGCUCAGUUCAGCAGGAACAG
miR-30-5p	950	956	1A	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-494	923	929	m8	hsa-miR-494^brain	UGAAACAUACACGGGAAACCUCUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: HTRA3