Gene Page: HTRA3
Summary ?
GeneID | 94031 |
Symbol | HTRA3 |
Synonyms | Prsp|Tasp |
Description | HtrA serine peptidase 3 |
Reference | MIM:608785|HGNC:HGNC:30406|Ensembl:ENSG00000170801|HPRD:08821|Vega:OTTHUMG00000090561 |
Gene type | protein-coding |
Map location | 4p16.1 |
Pascal p-value | 0.883 |
Fetal beta | -1.556 |
DMG | 1 (# studies) |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg02577436 | 4 | 8271369 | HTRA3 | 3.88E-5 | -0.323 | 0.02 | DMG:Wockner_2014 |
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs11265452 | chr1 | 160594237 | HTRA3 | 94031 | 0.15 | trans | ||
rs17093190 | chr20 | 34459279 | HTRA3 | 94031 | 0.09 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FBXO41 | 0.92 | 0.91 |
SHANK1 | 0.91 | 0.91 |
IQSEC2 | 0.91 | 0.92 |
GRIN1 | 0.90 | 0.94 |
PIP5K1C | 0.90 | 0.89 |
PITPNM2 | 0.90 | 0.93 |
PITPNM3 | 0.90 | 0.91 |
CBX6 | 0.90 | 0.87 |
SYN1 | 0.90 | 0.92 |
ZDHHC14 | 0.90 | 0.89 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RAB13 | -0.49 | -0.57 |
C21orf57 | -0.47 | -0.44 |
C9orf46 | -0.46 | -0.42 |
MYL12A | -0.46 | -0.52 |
RPS20 | -0.44 | -0.47 |
PECI | -0.44 | -0.45 |
GTF3C6 | -0.43 | -0.39 |
GNG11 | -0.42 | -0.43 |
RPS6 | -0.42 | -0.40 |
ANP32B | -0.42 | -0.46 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004252 | serine-type endopeptidase activity | IEA | glutamate (GO term level: 7) | - |
GO:0005515 | protein binding | IEA | - | |
GO:0005520 | insulin-like growth factor binding | IEA | - | |
GO:0008233 | peptidase activity | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001558 | regulation of cell growth | IEA | - | |
GO:0006508 | proteolysis | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR DN | 41 | 29 | All SZGR 2.0 genes in this pathway |
ZHOU INFLAMMATORY RESPONSE FIMA UP | 544 | 308 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2B | 392 | 251 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER HIGH RECURRENCE | 49 | 31 | All SZGR 2.0 genes in this pathway |
LIEN BREAST CARCINOMA METAPLASTIC | 35 | 25 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
ROZANOV MMP14 TARGETS UP | 266 | 171 | All SZGR 2.0 genes in this pathway |
TSENG IRS1 TARGETS DN | 135 | 88 | All SZGR 2.0 genes in this pathway |
GRADE COLON VS RECTAL CANCER UP | 38 | 21 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME2 AND H3K27ME3 | 59 | 35 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 6 | 75 | 48 | All SZGR 2.0 genes in this pathway |
LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
SERVITJA LIVER HNF1A TARGETS UP | 135 | 96 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS UP | 279 | 155 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
DURAND STROMA S UP | 297 | 194 | All SZGR 2.0 genes in this pathway |
NABA ECM REGULATORS | 238 | 125 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-101 | 932 | 938 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
hsa-miR-101 | UACAGUACUGUGAUAACUGAAG | ||||
miR-144 | 917 | 923 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG | ||||
miR-218 | 956 | 962 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-24 | 748 | 754 | m8 | hsa-miR-24SZ | UGGCUCAGUUCAGCAGGAACAG |
miR-30-5p | 950 | 956 | 1A | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA | ||||
miR-494 | 923 | 929 | m8 | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.