Gene Page: SEC22B
Summary ?
| GeneID | 9554 |
| Symbol | SEC22B |
| Synonyms | ERS-24|SEC22L1 |
| Description | SEC22 homolog B, vesicle trafficking protein (gene/pseudogene) |
| Reference | MIM:604029|HGNC:HGNC:10700|HPRD:04939| |
| Gene type | protein-coding |
| Map location | 1q21.1 |
| Sherlock p-value | 0.288 |
| Support | G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CNV:YES | Copy number variation studies | Manual curation | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| DYRK1A | 0.97 | 0.97 |
| ADNP2 | 0.96 | 0.97 |
| FOXJ3 | 0.95 | 0.96 |
| AP003115.1 | 0.95 | 0.97 |
| POLR3A | 0.95 | 0.96 |
| PDE12 | 0.95 | 0.95 |
| FAM115A | 0.95 | 0.97 |
| USP22 | 0.95 | 0.97 |
| AP1G1 | 0.95 | 0.96 |
| NUP153 | 0.94 | 0.97 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| FXYD1 | -0.80 | -0.86 |
| MT-CO2 | -0.79 | -0.86 |
| AF347015.31 | -0.79 | -0.85 |
| HIGD1B | -0.76 | -0.86 |
| AF347015.33 | -0.76 | -0.81 |
| S100B | -0.76 | -0.82 |
| IFI27 | -0.75 | -0.82 |
| AC021016.1 | -0.75 | -0.82 |
| AF347015.8 | -0.74 | -0.84 |
| MT-CYB | -0.74 | -0.81 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IPI | 15272311 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006888 | ER to Golgi vesicle-mediated transport | TAS | 9094723 | |
| GO:0016192 | vesicle-mediated transport | IEA | - | |
| GO:0015031 | protein transport | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000139 | Golgi membrane | IEA | - | |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0005789 | endoplasmic reticulum membrane | IEA | - | |
| GO:0005783 | endoplasmic reticulum | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0033116 | ER-Golgi intermediate compartment membrane | IEA | - | |
| GO:0042470 | melanosome | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG SNARE INTERACTIONS IN VESICULAR TRANSPORT | 38 | 25 | All SZGR 2.0 genes in this pathway |
| PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER ZNF217 AMPLIFIED UP | 78 | 48 | All SZGR 2.0 genes in this pathway |
| KIM WT1 TARGETS DN | 459 | 276 | All SZGR 2.0 genes in this pathway |
| WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 UP | 137 | 84 | All SZGR 2.0 genes in this pathway |
| BERENJENO TRANSFORMED BY RHOA DN | 394 | 258 | All SZGR 2.0 genes in this pathway |
| GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION DN | 206 | 136 | All SZGR 2.0 genes in this pathway |
| BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| CHEOK RESPONSE TO HD MTX DN | 24 | 18 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
| HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
| PELLICCIOTTA HDAC IN ANTIGEN PRESENTATION UP | 64 | 40 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO CSF2RB AND IL4 UP | 338 | 225 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF UP | 418 | 282 | All SZGR 2.0 genes in this pathway |
| RUTELLA RESPONSE TO HGF VS CSF2RB AND IL4 UP | 408 | 276 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-1/206 | 455 | 461 | m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
| hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
| hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
| miR-19 | 621 | 627 | 1A | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
| hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
| miR-23 | 530 | 536 | 1A | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
| hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
| miR-378 | 54 | 60 | 1A | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.